Transcript asmbl_55768

Sequence
Transcript Sequence for observation asmbl_55768 of TGE0046833:
CGTGTGGCGGCGAGATGTCTCACAGGAAATTCTCAGCTCCCAGGCATGGGTCCTTGGGCTTCCTGCCTCGAAAGCGCAGCAGCCGGCATCGTGGGAAAGTGAAGAGCTTCCCTAAGGATGACGCTTCCAAGCCCGTTCACCTCACAGCCTTTCTGGGTTACAAGGCTGGCATGACCCACATCGTCCGGGAAGTTGACAGGCCAGGATCTAAGGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAAACTCCCCCAATGGTGGTTGTGGGCATTGTGGGATATGTTGAGACCCCACGAGGCCTCCGGACCTTCAAGACTGTATTTGCTGAGCACATCAGCGATGAGTGTAAAAGGCGCTTCTATAAGAACTGGCACAAGTCTAAGAAGAAGGCTTTCACCAAGTACTGTAAGAAATGGCAGGATGACACAGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGCATGAAGAAGTACTGCCAGGTCATCCGCATCATTGCCCACACTCAGATGCGTCTGCTTCCTCTACGCCAGAAGAAGGCACACTTGATGGAGATCCAGGTGAATGGAGGCACTGTGGCTGAGAAGCTCGACTGGGCCCGAGAGCGGCTGGAGCAGCAGGTTCCTGTGAACCAGGTGTTTGGGCAGGATGAGATGATTGATGTCATTGGCGTGACAAAAGGCAAAGGGTACAAAGGGGTAACCAGTCGTTGGCATACAAAGAAACTGCCCCGAAAGACCCATCGAGGTTTGCGCAAAGTTGCCTGTATTGGAGCCTGGCACCCTGCCCGTGTCGCCTTCTCTGTGGCTCGAGCTGGGCAGAAAGGCTACCATCACCGAACAGAGATTAACAAGAAGATTTACAAGATTGGTCAAGGCTACCTCATCAAGGATGGCAAACTGATCAAGAACAATGCATCTACTGACTATGACTTGTCTGACAAGAGCATCAACCCACTGGGTGGCTTTGTGCATTATGGTGAGGTGACCAATGACTTCATCATGCTCAAAGGCTGTGTGGTGGGGACCAAGAAGCGAGTACTTACTCTTCGTAAGTCCTTGCTGGTTCAGACCAAACGTCGGGCCCTGGAGAAGATTGACCTGAAGTTCATTGACACCACCTCCAAATTTGGCCATGGTCGCTTCCAGACCATGGAGGAGAAGAAAGCATTTATGGGACCACTCAAGAAAGATCGCATTGCCAAGGAGGAAGGAGCTTGATTCCAGGACCACTTTGTGCAGATGGTGGGGTCTCACCAATAAAATATTTCTACT