Transcript asmbl_61298

Sequence
Transcript Sequence for observation asmbl_61298 of TGE0006790:
ACCAGCAGCAGCAGCAGCAGCAGCCCCCCACCCTTCCCGAATACGAGCACCACAGGGGCCCGGAAGCCCGCACAGGCGTTTAGAGAACATGGCAGACGATATTGATATTGAAGCAATGCTTGAGGCTCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGGCGAGATGTGTGACAGAGGTGGCATCAAGCTCTTACAGTCCCAACCCTCCAACGGAAATGGGCGAAGATCTCAGGAATGGCATCGGTCACAGGAAATCGATAGTGGCTGGCTGCTAGCATGGCCACTTGGGGCTTAGGCAGAAATAGAGCCATGGTACTGACCAAAGGGACCATAGCACATGGAATAAAACTCAAAACAGGACTTCATTCATGTTTTAAAGAAATTCTATTTAACCACTTCAACACTAAATCTGGAATACTTAATATCTATATAAGAAAGTAAAATTTAACATGTTAATATGTATTTTTATTTTTGTATTTTGATGACTTAATTGTAAGCAACAAAGTGGTTAAACAACACATATCCATCTAAATTTTTTTATAGCCTTCCATGTTAAACTATAAATAAGTAATTAGTTTTAAAATTGTTTTGTATTTTCTTATTCCTGTTCCCTTTACCCTTTGACAACTTGAAATGTTACCACTTCGTCCTCATGATGTTCTTCTATCAACCCTGCTTAGGATGAGAACAAGTTGAGCAGTGCTAATGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAAAGAAGCAAAAGTAAGGAACGGAAGCGAAGCAGGGATAGAGAAAGGAAAAAGAGCAAAAGTCGTGAAAGGAAGCGAAGTAGAAGCAAAGAAAGGAGACGGAGCCGCTCAAGAAGTCGAGATCGCAGATTCAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGCTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGTCCTGTGAGGGAACCAATTGATAATCTAACTCCTGAGGAAAGAGATGCAAGGACAGTTTTCTGCATGCAGCTGGCAGCAAGAATTCGGCCAAGGGATTTGGAAGAGTTTTTCTCTACAGTTGGGAAGGTTCGAGATGTAAGGATGATATCTGATAGAAATTCAAGACGTTCCAAGGGCATTGCTTATGTGGAGTTTGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGTGTTTTAGGAGTGCCAATCATAGTACAGGCGTCACAGGCGGAAAAAAACAGAGCTGCAGCAATGGCAAACAATCTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCCTTACACTTTAACATAACTGAGGATATGCTTCGGGGGATCTTTGAACCTTTTGGCAGGATTGAAAGTATCCAGCTCATGATGGATAGTGAAACAGGTCGATCTAAGGGATATGGATTTATTACGTTTTCCGATTCAGAATGTGCCAAGAAGGCTTTGGAACAACTTAATGGATTTGAGCTGGCAGGAAGGCCGATGAAAGTTGGACATGTTACTGAACGTACTGATGCTTCCAGTGCTAGCTCATTTTTGGACAGTGATGAATTGGAAAGGACTGGAATTGACCTGGGAACAACTGGTCGTCTCCAATTAATGGCAAGACTGGCAGAGGGTACAGGTTTGCAGATCCCACCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCTCAACAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAACCTCTTGCAACACAGTGTTTTCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTGATTGAAGAATGTAATAAACACGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAACGTGTATGTGAAGTGCCCATCAATTGCTGCAGCCATTGCTGCTGTCAATGCATTACATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTATCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTACATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAATTCCTGTTATCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAACTAGCAATTCCCACTGTATACAAAGCTGTTCTCTAGTTCTGCCTTTTAAATGTACATGTAGAAAATTACATTAAGGATCTATAGAAATAGCTCTAGGGGAACAAATGTGCTTAATGTAAAAAGGCAGACAGGGATGTAATGATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGCAGTTACATTTCTCATTCACTAATGTTGATATTTGGCTAATGGTTTAGCAGAGGTTTCTGGAATACACTTTTAGTGAATGGAAATTGAAGACAGCTAAAGGGCTGTTGATTAACATCTCATCTTGCATTCTGGTCAATTGGCAAGAAAAGGAGATTTCAAAATTAACATTTCTGGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATATGTGTTCTAGTGTGTCTAAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGATGTTTAGTGACAGTCTGGTAAGGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTTAAAAAGGCCATAAGAAAATCTTCATTTTTGAAATGTTTTAAAGTCATAGAAACTTGAAAATAGAATACTAGTTTCTTTGACTCGGTATTTGCCTCTTTGGGAAAATTCTTAGCATGCAGAGTCTGGATATATTTGCCCTCAAGTTGTCCC