Transcript asmbl_55308

Sequence
Transcript Sequence for observation asmbl_55308 of TGE0003118:
GAGCAACCCAGGCTCCAGCGCGCGCGCAGCCTCCGACCCTAATTTCTTCGTTCGCCGGAAGAAGGCGAGTCTCTTTCCGTTCCTAGCGCAGCCATGGCTCGTGGTCCCAAGAAACACCTGAAGCGTGTAGCTGCTCCAAAACATTGGATGCTGGATAAGTTGACTGGCGTGTTTGCTCCTCGTCCATCCACTGGTCCTCACAAGCTGAGGGAATGCCTGCCTCTCATCATTTTCCTAAGGAACAGACTTAAGTATGCCCTGACTGGAGATGAAGTAAAAAAGATTTGCATGCAGCGATTCATTAAGATTGATGGGAAAGTCAGGACCGATATAACCTACCCTGCTGGGTTTATGGATGTCATCAGCATTGACAAGACCGGAGAGAACTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCATCGTATTACACCGGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTAGGCACAAAAGGAATCCCGCACCTGGTGACCCATGATGCTCGTACTATTCGGTACCCTGATCCCCTCATCAAGGTGAACGACACCATTCAGATTGATTTGGAGACAGGCAAAATAACTGACTTCATCAAGTTTGACACTGGGAACCTGTGTATGGTGACTGGAGGTGCTAACTTGGGAAGAATTGGTGTAATCACCAACAGAGAGAGACATCCCGGCTCTTTTGATGTGGTTCATGTGAAAGATGCCAATGGCAACAGCTTTGCCACTCGGCTGTCCAACATTTTTGTTATTGGCAAGGGTAACAAACCATGGATCTCTCTTCCCAGAGGAAAAGGAATCCGCCTCACCATTGCTGAAGAGAGAGACAAGAGGCTTGCGGCCAAACAGAGCAGTGGGTGAAATGGTCTCTAGGAGACATGCTGGAAAAGTGTTTGTACAAGCCTTTCTAGGCAACATACATGCTAGATTAAACAGCATGGTGAAACTA