Transcript asmbl_11041

Sequence
Transcript Sequence for observation asmbl_11041 of TGE0000068:
GCGGCGGGGTTCTCGGTCGCCAGCCATTCCTGAGGAGGACTGCCGGTCGTTCGGACGTCTTGCCTGTCGCTGGAGGAGAGGTCCGGGCTCTCCAGGAAGGTGGCTGCGGCGACAAAATGAAGATATTCGTGGGCAACGTCGACGGGGCGGATACGACTCCGGAGGAGCTGGCAGCCCTCTTTGCGCCCTACGGCACGGTCATGAGCTGCGCCGTCATGAAACAGTTCGCCTTCGTGCACATGCGCGAGAACGCGGGCGCGCTGCGCGCCATCGAAGCCCTGCACGGCCACGAGCTGCGGCCGGGGCGCGCGCTCGTGGTGGAGATGTCGCGCCCAAGGCCTCTTAATACTTGGAAGATTTTCGTGGGCAATGTGTCGGCTGCATGCACGAGCCAGGAACTGCGCAGCCTCTTCGAGCGCCGCGGACGCGTCATCGAGTGTGACGTGGTGAAAGACTACGCGTTTGTTCACATGGAGAAGGAAGCAGATGCCAAAGCCGCAATCGCGCAGCTCAACGGCAAAGAAGTGAAGGGCAAGCGCATCAACGTGGAACTCTCCACCAAGGGTCAGAAGAAGGGGCCTGGCCTGGCTGTCCAGTCTGGGGACAAGACCAAGAAACCAGGGGCTGGGGATACGGCCTTCCCTGGAACTGGTGGCTTCTCTGCCACCTTCGACTACCAGCAGGCTTTTGGCAACAGCACTGGTGGCTTTGATGGGCAAGCCCGTCAGCCCACACCACCCTTCTTTGGTCGCGACCGCAGCCCTCTGCGCCGTTCACCTCCCCGAGCCTCTTATGTGGCTCCTCTGACGGCCCAGCCAGCTACCTACCGGGCCCAGCCGTCCGTGTCACTGGGAGCTGCCTACAGGGCCCAGCCTTCTGCCTCTTTGGGTGTTGGCTATCGGACTCAGCCCATGACAGCCCAGGCAGCCTCTTACCGCGCTCAGCCCTCTGTCTCCCTTGGGGCACCATACAGGGGCCAGCTGGCTAGTCCTAGCTCCCAGTCTGCTGCAGCTTCTTCACTCGGCCCATATGGTGGAGCCCAGCCCTCAGCCTCGGCCCTTTCCTCCTATGGGGGTCAGGCAGCTGCAGCTTCTTCGCTCAACTCCTATGGGGCTCAGGGTTCCTCCCTTGCCTCCTATGGTAACCAGCCATCCTCTTACGGCGCCCAGGCTGCCTCTTCCTATGGGGTTCGTGCAGCTGCTTCTTCCTACAACACCCAGGGAGCAGCTTCCTCCTTAGGCTCCTACGGGGCTCAGGCAGCCTCCTATGGGGCCCAGTCTGCAGCCTCCTCACTAGCTTATGGAGCCCAGGCAGCTTCATATAATGCCCAGCCCTCGGCCTCTTACAATGCCCAGTCTGCCCCATATGCTGCACAGCAGGCTGCTTCCTACTCTTCCCAACCTGCTGCCTATGTGGCACAGCCAGCCACAGCTGCTGCCTATGCCAGCCAGCCAGCAGCCTACGCCGCACAAGCCACTACCCCAATGGCTGGCTCCTATGGGGCCCAGCCGGTTGTGCAGACCCAGCTGAATAGTTACGGGGCCCAAGCATCAATGGGCCTTTCAGGCTCCTATGGGGCTCAGTCGGCTGCTGCGGCCACTGGCTCCTATGGTGCCGCAGCAGCCTACGGGGCCCAACCTTCTGCCACCCTGGCAGCTCCTTACCGCACTCAGTCATCAGCCTCATTGGCTGCTTCCTATGCTGCCCAGCAGCATCCCCAGGCTGCTGCCTCCTACCGCGGCCAGCCAGGCAATGCCTACGATGGGGCAGGTCAGCCGTCTGCAGCCTACCTGTCCATGTCCCAGGGGGCCGTTGCCAACGCCAACAGCACCCCGCCGCCCTATGAGCGTACCCGCCTCTCCCCACCCCGGGCCAGCTACGACGATCCCTACAAAAAGGCTGTCGCCATGTCGAAAAGGTATGGTTCCGACCGGCGTTTAGCCGAGCTCTCTGATTACCGCCGTTTATCAGAGTCGCAGCTTTCGTTCCGCCGCTCGCCGACAAAGTCCTCGCTGGATTACCGTCGCCTGCCCGATGCCCATTCCGATTACGCACGCTATTCGGGCTCCTATAATGATTACCTGCGGGCGGCTCAGATGCACTCTGGCTACCAGCGCCGCATGTAGGGCCATCCTGGGATGGGGCACCACAGGGAGGGAGGGAGAAAAGAGGTGGGTAGGGTTACAGATCCAGGTTATAACTACTCTGGCCCATACCTTTCCTGGTTGTGGTTTTTCATGCCCTCTACCATGTGGGCCTTCCCCAGGAGATGATCCTGTTAAGTGTTCGGCAGTAACCTACTTTGTTCCTTCGCCTCAGCAGCAAATCTTGCTACTGGCTCTAGATCTGCGGTTTCCCCTCTACCCTGCCTCCCGTCTCCCCAGAATGGGAATTTCTTTTATGTTTTTATTTTTTTCCTGGCTCCCTTTTATTTTTGTGCGCGATATTTAAGGTCGTCTGGATGGGGAAGCAACCTGCAGCTGAGGTCGCCGGCGCCTTTTTCTTTTTAGATGGGAAGGAGGCCAGGAAAGGGTCAGCTTAACCATTTCCTATGTGCCAAGCTGTGCCAGCAGTCCAGGGTACCCTGACTGTCCCTCTGTAGACTGTTGAGACTGAGTTCCTGTTGGGACAGTCAGTTGGTATGTATCCAAGTCCCTGCTGACCACTAATGTTCTAGCTGATGGTGAGCGGCACAGTCCCACTTCCCCATCTCCCCAAGTAGGTGGTGTTAGAAAACCTTAATTTTTTTTCCCTTTTGTATGGACTACAAATAAAACTTGGGGCAATTTGCAGTTTGGAAACCTG