Transcript asmbl_61206

Sequence
Transcript Sequence for observation asmbl_61206 of TGE0006772:
CCAGCAGCGGGCGCCATGGTGCTGCTGCACGTGCTCTTCGAGCACGCGGTTGGCTACGCGCTCCTGGCGCTAAAGGAAGTGGAGGAGATAAGCCTGCTGCTACCGCAGGTGGAGGAGTGCGTACTTAACCTAGGCAAGTTCCACAACATCGTTCGTCTCGTGGCCTTTTGCCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAACGCTGTGTCTGAAGGTGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACTCACCTGCCATCCAAAAAGAAGAAAGTACTTTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAAGAGGAGTTAGGGTACACTTGCCAGACTGGAGGCGTGATAGCTGAGATCCTTCGAGGAGTTCGTCTGCACTTCCACAACCTGGTGAAGGGTCTGACCGATGTGTCTGCTTGTAAAGCCCAGCTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATTATCCAGTCCATTAGCCTTCTGGACCAGCTGGATAAGGACATCAATACCTTCTCCATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCTGAACTGGTGAAGATCATCAATGACAATGCTACGTACTGCCGCCTTGCTCAGTTCATTGGGAACCGGAGAGAGCTGAATGAAGAAAAGTTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCGCGGTCCTCCATGGGTATGGACATATCAGCCATAGACTTGATAAACATCGAGAGTTTCTCCAATCGTGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTGCACACTTATCTGCGATCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGCGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACTTGCCCACACTCAGGTACCACTTCTGGTGCCCACTGCTTGTTTGGGGATCACAGTGATGGCTGACCAGGGCTTCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCGAGTTTCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTTTCTGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA