Transcript asmbl_22603

Sequence
Transcript Sequence for observation asmbl_22603 of TGE0000696:
GGGTCGGGCCCTCCGGGAAGATGGCGGCCGTGCAGGCGGCCGAGGTGAAAGTGGATGGCAGCGAGCCGAAACTGAGCAAGAAGTGGTGGTAATCATTAGTTCCAGGGTGCTCTGCCATGTTGACGCAAGCTGCTGTAAGGCTTGTTAGGGGGTCCCTGCGCAAAACCTCCTGGGCAGAGTGGGGTCACAGGGAACTGCGACTGGGTCAACTTGCTCCTTTCACAGCGCCTCACAAGGACAAGTCATTTTCTGATCAAAGAAGTGAGCTGAAGAGACGCCTGAAAGCTGAGAAGAAAGTAGCAGAGAAGGAGGCCAAACAGAAAGAGCTCAGTGAGAAACAGCTAAGCCAAGCCACTGCTGCTGCCACCAACCACACCACTGATAATGGTGTGGGTCCTGAGGAAGAGAGCGTGGACCCAAATCAATACTACAAAATCCGCAGTCAAGCAATTCATCAGCTGAAGGTCAATGGGGAAGACCCATACCCACACAAGTTCCATGTAGACATCTCACTCACTGACTTCATCCAAAAATATAGTCACCTGCAGCCTGGGGATCACCTGACTGACATCACCTTAAAGGTGGCAGGTAGGATCCATGCCAAAAGAGCTTCTGGGGGAAAGCTCATCTTCTATGATCTTCGAGGAGAGGGGGTGAAGTTGCAAGTCATGGCCAATTCCAGAAATTATAAATCAGAAGAAGAATTTATTCATATTAATAACAAACTGCGTCGGGGAGACATAATTGGAGTTCAGGGGAATCCTGGTAAAACCAAGAAGGGTGAGCTGAGCATCATTCCGTATGAGATCACACTGCTGTCTCCCTGTTTGCATATGTTACCTCATCTTCACTTTGGCCTCAAAGACAAGGAAACAAGGTATCGCCAGAGATACTTGGACTTGATCCTGAATGACTTTGTGAGGCAGAAATTTATCATCCGCTCTAAGATCATCACATATATAAGAAGTTTCTTAGATGAGCTGGGATTCCTAGAGATTGAAACTCCCATGATGAACATCATCCCAGGGGGAGCCGTGGCCAAGCCTTTCATCACTTATCACAACGAGCTGGACATGAACTTATATATGAGAATTGCTCCAGAACTCTATCATAAGATGCTTGTGGTTGGTGGCATCGACCGGGTTTATGAAATTGGACGCCAGTTCCGGAATGAGGGGATTGATTTGACGCACAATCCTGAGTTCACCACCTGTGAGTTCTACATGGCCTATGCAGACTATCACGATCTCATGGAAATCACGGAGAAGATGGTTTCAGGGATGGTGAAGCATATTACAGGCAGTTACAAGGTCACCTACCACCCAGATGGCCCAGAGGGCCAAGCCTACGATGTTGACTTCACCCCACCCTTCCGGCGAATCAACATGGTAGAAGAGCTTGAGAAAGCCCTGGGGATGAAGCTGCCAGAAACGAACCTCTTTGAAACTGAAGAAACTCGCAAAATTCTTGATGATATCTGTGTGGCAAAAGCTGTTGAATGCCCTCCACCTCGGACCACAGCCAGGCTCCTTGACAAGCTTGTTGGGGAGTTCCTGGAAGTGACTTGCATCAATCCTACATTCATCTGTGATCACCCACAGATAATGAGCCCTTTGGCTAAATGGCACCGCTCTAAAGAGGGTCTGACTGAGCGCTTTGAGCTGTTTGTCATGAAGAAAGAGATATGCAATGCGTATACTGAGCTGAATGATCCCATGCGGCAGCGGCAGCTTTTTGAAGAACAGGCCAAGGCCAAGGCTGCAGGTGATGATGAGGCCATGTTCATAGATGAAAACTTCTGTACTGCCCTGGAATATGGGCTGCCCCCCACAGCTGGCTGGGGCATGGGCATTGATCGAGTCGCCATGTTTCTCACGGACTCCAACAACATCAAGGAAGTACTTCTGTTTCCTGCCATGAAACCCGAAGACAAGAAGGAGAATGTAGCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAAATAATAATTGCAAGTTGTATAACTCAGGCGTCTTTGCATTTCTGCGAAAGATCAAGGTCTGCAAGGGAATTCTTGTGTGCTGCTTTCCATTTGACACCGCAGTTCTGTTCAGCCATCAGAAGAGAGACAAGGAATTAAAAATTTCTTTTTAATCCTGTTACCAAATAAGCCAT