Transcript asmbl_48809

Sequence
Transcript Sequence for observation asmbl_48809 of TGE0004149:
CTCGTGGTTCCCAGTGGCGAGAGGAGGAGGAAGCCCGGAGCGGAGCGGGGCGGCTGGGGGGGGTGGACCCGCCGCGGCTGCTGCTGCCACCGCCGCCGCCGCCACCACCGCTCGTGGGGCTCGTGGCGTGAGGAAGGAGGACGAGTGAGACCCCGGGGCGAGCGGGCGGCGGCGCCGCTGCTGCTGCTGCTGCGGGAGGGTCGGCGGCGGGACGGCGATGGCGGATATCGACAAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCAGGCAAGAATGTCCAGCTCCAGGAGAACGAGATCCGAGGACTCTGCCTGAAGTCTCGGGAGATCTTCCTCAGTCAGCCTATCCTTTTAGAACTTGAAGCACCACTCAAGATATGTGGTGACATCCACGGGCAGTACTATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTCCAGAGAGCAACTATTTGTTTCTCGGGGACTATGTGGACAGGGGCAAGCAGTCCCTGGAGACAATCTGCCTCTTGCTGGCCTACAAAATCAAGTATCCGGAGAACTTCTTTCTTCTCAGAGGGAACCACGAGTGCGCCAGCATCAATAGGATCTACGGATTTTATGATGAGTGTAAAAGAAGATACAACATTAAGCTGTGGAAAACGTTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGTGGACGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGCTATGAGTTTTTTGCAAAGAGGCAGTTAGTCACTCTGTTTTCTGCACCCAACTACTGTGGCGAGTTTGACAATGCAGGCGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTTCCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCCAACGCCACGAGACCTGTCACACCACCACGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCACTTGACACTGCCTGGTTGGGACTTGTAACATAGCGTTCATAACCTTCCTTTTTAAACTGTGATGTGCTGGTCAGCTTGCCCAGGTAGACCTGTCTGTCGGGCCCTCCTCCATTTGATTACTGCTGGCACTTGCTGGTTATAGCAGCAAGCCAAGCACTTCATTCTCAAGAGAGCATTTTGTTTTGAACCTCTGTTCCCTTTGTGGACAGCTCTGATGATGGTGTTAAGCTGTACACCCTGGCAGGTTATCCTGTCTGAGGAGAAAGTGTACAATTGATCTTTTTTTAATTTAGTATAAGTCATGAATAATGTAAATGCCTGTTTTCTTTAGGATATAAAGAGAGCCTTAGAGTGCGTGAGTCTCTACATGTAATTGTCATAAATGCATTCTGTTGATACAAACCACTGTGAACAATTTTTTTTCCAGTTTGTTTGAAAGGGACTGCTTTCCCTCATTGTCTTGTCATGTACAAACTAGTGTCTGCAGCTGTGGCAGCAGGAGTGACCTGCCTGCCGCCAGCCCTGCCCAGACTATCTGAAGCACACTCCTTCCCACTGCACATTTAATAATGATTAAAGCCATTCTTTTCAATGTCTGTGATTCCTTCCTAAAGCCAAAGTTTCTGTTGGACTGTATGGCACGCCCTGGGGATGAGGTGGCCAGGGCATCGAGGCTGCGTGCGCAGGCCGCCTCCCTCCGTGGGGCCTCAGAAGCAGGTTATTTTAACTAGCAATAGTGGTATAGTGCTGAGTAAGCTATTAATGATGGAAGTTAATGACACTTTGTACAGTTCCCATATAGTCTATTCACTGAGTGATCTTTTTACAGTTGGATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAACACTGTCCTATACGAGTGACCGATAATGCTTTCTTTGGCTACATTCTTTATTCTGCGGTGACATTGAGGCTTATAAATCAAAAGGAACTAACTTGCCGTCCACCGGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAACTACGACCTGTTAAATGAATCTGTTTGCACAGATGCCCGTGTACAATGCCATGTGCTGAGAATGGTTTCAGACTTATTAAATGCAAGCTTGTTAA