Transcript asmbl_46639

Sequence
Transcript Sequence for observation asmbl_46639 of TGE0046444:
CTCTCTCTTTCTCGGCAAGATGGCTTCTCCGGCCGTACCGGCTAATGTCCCTCCTGCCACTGCAGCCGCAGCCCCGGCGCCGGTCGTCACCGCAGCCCCGGCTTCAGCCCCGACCCCATCCACGCCAGCTCCGACACCGGCTGCGACTCCCGCTGCGTCCCCGGCGCCCGTCTCGTCTGATCCTGCTGTAGCTGCGCCTGCAGCCCCGGGCCAGACCCCAGCCTCCGCGCCAGCCCCAGCGCAGACGCCGGCGCCTTCGCAGCCCGGGCCCGCCCTCCCGGGGCCTTTCCCGGGCGGCCGCGTGGTCAGGCTACACCCCGTCATTTTGGCCTCGATCGTGGACAGCTACGAACGCCGCAACGAGGGAGCTGCCCGAGTTATTGGAACCCTGTTGGGAACTGTTGACAAGCACTCGGTAGAAGTCACCAACTGCTTTTCGGTGCCACACAATGAGTCAGAAGATGAAGTGGCTGTTGACATGGAATTTGCTAAGAATATGTATGAATTACATAAAAAAGTCTCCCCAAATGAGCTCATCCTAGGCTGCACTTTAATGGGTGTCCCTGGGAGGACCATGGGAGTGATGTTCACACCTCTCACAGTGAAGTACGCGTATTATGACACTGAACGCATTGGAGTTGACCTCATCATGAAGACGTGTTTTAGCCCCAACCGGGTGATTGGACTCTCAAGTGACTTACAACAAGTGGGAGGGGCCTCAGCTCGCATCCAGGATGCTCTAAGCACTGTATTACAGTATGCTGAGGATGTGCTGTCTGGGAAAGTGTCTGCTGACAACACGGTGGGCCGCTTCTTGATGAGCCTTGTCAACCAAGTACCCAAGATAGTTCCTGATGACTTTGAGACCATGCTCAACAGCAACATCAATGACCTGCTGATGGTGACCTACCTGGCCAATCTCACCCAGTCACAGATTGCCCTCAACGAGAAACTTGTAAACCTGTGAATGAGCCCCAAGAGGCACTTGTGCTGGTCGAGGTTTTCACCACAGGGCTGAGACCGAAGTGGAGGCAAAGGGTTTCTTTGTGGTCTTGAGTCACGGTGACTCAGTCAGCTGCTTGTGACTCCAAATAAACATAGCTTACCTTTTGTAAATG