Transcript asmbl_46128

Sequence
Transcript Sequence for observation asmbl_46128 of TGE0001056:
GCCAAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTT