Transcript asmbl_59852

Sequence
Transcript Sequence for observation asmbl_59852 of TGE0006720:
CTCCGCCTGGCTTCCTGTTTCTGGAATGGGCTGGTGTGAGCGGAGTCCCGCGAGATGCCGGGCTCGTCCTGAGCCTGCGGGACGCGGGGCCGGTTCCTCGTTACTCATCCGCACTCTTTCTTTGTGCTCTTTCTCCTTTCTCCTCCTTTAGACAAGCTGGCCAGCCCGCCGGCCTCGGCCGCAGCCTCCAGCCCTAGCTCCTCTCCATCTCCACAGCCCGTTTCAGAGCCCGACCTGTGCTCAGAGCCACACCAGCTCGCTTCCAAGGGAGCTGGTTTTCCATCTGCCCCCGTCGGCAAGAGCCCCATGGTGGAGCAGGCTGTCCAGACCGGTTCCCTCGATAACCTGAATGCCAGGAAGCCGTCGCCCGGCAAGGGCACAGTGGGGATGCAGCTCAACGGGCGCCCGACCCCGCCAGGCAGCAAGAGCGCCAGCGATGTAGCCCAGCCGGCCACAGTGCAAACCCAAGGGCAGGTGAACGACGAAAACAGAAGGCCCCAGAGGAGGAGATCAGGGAATAGACGAACCAGGAATCGCTCCAGGGGGCAAAGCCGCCCAACTCACGTCAAGGAGAATACCATCAAGTTCGAAGGCGACTTTGATTTTGAGAGTGCAAACGCCCAGTTCAACCGTGAGGAGCTGGACAAGGAGTTTAAGAAGAAACTGAATTTTAAAGATGACAAAGTGGAGAAAGGGGAGGAGAAGGACCCGACACTGGTGACCCAGAGTGACGAGGTGCCAGCCGAGGAGGACCACCTGGGGCCCAACTGCTACTACGACAAGTCCAAGTCCTTCTTCGACAATATCTCCTCTGAACTCAAGACCAGTTCCAGGAGGACCACATGGGCCGAGGAGAGGAAGCTCAACACGGAGACCTTCGGGGTGTCGGGAAGGTTTCTCCGTGGCCGCGGTTTCCGGGGCGGATTGCGAGGGGGCAGGGGCACCGGTACGACCCGGCGCAACCCTACTTCCCACCGAGCTGGGACGGGCAGAGTGTGAGGGGGCAGCCAGAGGCTCCTGCCGAAGCAGCGGAGACGAATCTGTGAGGGCCACGGAGGACGCCGCATTTACGGGAGACGCTGGGCCCCTCTGTTTACTGTTTGCAGAATTCCCACGTGCTACTTTTGTTCTGGACTTCACGCGACTTGGACGTGGTCTGAGTTGGAACCACTTGTTTTGGGGAAGTGTTTATGGGAAGCCTCTCCGGGGCATCAAGATCTTTTGTTCTTACTTGCACACAGTGTAATCTAAGGTTTTGGTATTTTGCAAAGAGGTTTCTAGAACGAAAGCTCGATTCTCATTTCGTGACTTTTTTTTGGCCGCTTTGACTTTGAAAGTGGAACCAAATCTCCTTGGGCAGTGTGGCAGCCGGGCGCGGCTCTGTAATCCAGCTGGCCCCTGGTGTTGCTGGCCTGGCACCCCCGTGCCAGGTGGGGTCTCAGGAGCCAGGCAGGGCCAGCACAGGGGTGAG