Transcript asmbl_59827

Sequence
Transcript Sequence for observation asmbl_59827 of TGE0006717:
TCCGCTCTGAGTGGGCACGCCCTGGCTTTCTCTTTTTTTCCTTTTAGTTTTGGGATACGCGATCATCAAATCCTATGATGGTTTTGCAACTCCCTGAAAGGTGTTACTGTGCCGACGTGATATATCCTATGGCCGTGGTGGCCACTGCAGAGAGAGGACTGATTGTCTATCAATTAGAGAACCAACCTTCTGAATTCAGGAGGATAGAATCCCCACTGAAACACCAGCATCGATGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGTTTTGCCTTGGGAAGTATCGAGGGGAGAGTTGCTATCCACTACATCAACCCCCCGAATCCAGCCAAAGATAACTTTACCTTTAAATGTCATCGATCTAACGGAACCAATACTTCAGCTCCTCAGGATATCTACGCGGTCAATGGAATCGCGTTCCATCCTGTTCATGGTACACTTGCCACGGTGGGATCTGATGGCAGATTCAGCTTTTGGGACAAAGACGCCAGAACAAAACTTAAAACTTCAGAACAGTTAGATCAACCGATATCGGCTTGCTGCTTCAATCACAATGGAAACATATTCGCATATGCTTCCAGCTACGACTGGTCAAAGGGACATGAATTTTATAATCCCCAAAAGAAAAATTACATTTTCCTGCGTAACGCAGCCGAAGAGCTGAAGCCCAGGAACAAGAAGTAGGGGAGCCTCCTGGCTGCCACAGCGCCTTCCTCTCCACTCTGCCTCGTCTCACGAACTTGGGTCCCAGCTTTTTGTGGGTTCAGCCATGGATGTGGATTCCAACCCTCGGGGAAAACTGTCATTGTTTGGCAGTCGGGCCCAGCGGGCCACAGTGACCGTTGGTCTCTCCATTCCACTGCCCATTACAGACGTCTCTGGAACTGTGAGGGGGTTGGAGTCGCTGTAGAAGTTAGGTCCCTGCGGGCGACTGCCAGGCATTCGCAGTCTTCGCTCAGCAGCGTGTGTATAGAGAACACTGGGAATCATTTTGTGAACCCTGGACTGTATTTTGTAATAAAGCATTTCGAAGATTGTCTCCTAAGCTCACTGTGTCC