Transcript asmbl_43457

Sequence
Transcript Sequence for observation asmbl_43457 of TGE0046299:
CGGTGTTTCGGGCCCTTTAAGAGGCGACGCCGGAGCCGGAGCCATTTTCCCCCCTTCGGCCGCGGCGAGGAGGAGCTGGAGCGGGAGTGACACCGGCGAGACCCAGCGCGACCTGAGGCGGCTCTAGGTGACTCGGGCCAGTGCAGAGGGCCCCAGGCCGCAGGCAGGAGCAGCTGGGCCAATTCCCTGGCCGGGGAACGGAAGGGGATGGCGTCGGGCCTGGGCTCCCCGTCCCCCTGCTCAGCGGGCAGTGAGGAGGAGGATATGGACGCACTTCTGAACAACAGCCTGCCCCCACCCCATCCAGAAAATGAGGAAGACCCAGACGAGGATTTATCCGAAGCAGAGACTCCAAAGCTCAAGAAGAAGAAAAAGCCTAAGAAACCTCGAGACCCTAAAATCCCTAAGAGCAAGCGCCAAAAAAAGGAGCGTTTACTCTTATGCCGGCAGCTGGGGGACAGCTCTGGGGAGGGGCCAGAGTTTGTGGAGGAGGAGGAAGAGGTGGCTCTGCGCTCAGACAGTGAGGGCAGCGACTATACTCCTGGCAAGAAGAAGAAAAAGAAGCTCGGACCTAAGAAAGAGAAGAAGAGCAAATCCAAGCGGAAGGAGGAGGAGGAAGAGGAGGACGAGGATGATGACTCGAAGGAACCTAAGTCATCAGCCCAGCTTTTAGAAGACTGGGGTATGGAAGACATCGACCATGTGTTCTCAGAGGAGGATTATCGGACCCTCACCAACTACAAGGCCTTCAGCCAATTTGTTAGACCCCTGATTGCTGCTAAAAACCCCAAGATTGCTGTCTCCAAGATGATGATGGTCTTGGGTGCAAAGTGGAGGGAATTCAGTACCAACAACCCCTTCAAGGGCAGCTCCGGAGCATCAGTGGCAGCTGCGGCGGCGGCGGCTGTGGCTGTGGTTGAGAGCATGGTGACAGCTACTGAAGTCGCCCCTCCCCCTCCCCCTGTGGAGGTGCCGATCCGCAAGGCCAAGACCAAGGAGGGCAAAGGTCCCAATGCTCGGAGGAAGCCGAAAGGCAGCCCGCGAGTGCCTGACGCCAAGAAGCCCAAACCCAAGAAAGTAGCTCCTCTGAAGATCAAGCTGGGAGGGTTCGGCTCCAAGCGGAAGAGATCCTCGAGTGAGGACGACGATTTAGATGTAGAGTCTGACTTCGACGATGCCAGTATCAACAGCTATTCTGTTTCGGATGGTTCCACCAGCCGCAGTAGTCGGAGCCGTAAGAAACTCCGGACCGCTAAAAAGAAAAAGAAAGGCGAGGAGGAGGTGACTGCTGTGGATGGTTATGAGACAGACCACCAGGACTATTGCGAGGTGTGCCAGCAAGGCGGCGAGATCATCCTGTGTGATACCTGTCCCCGAGCCTACCATATGGTGTGCCTGGACCCAGACATGGAGAAGGCCCCGGAGGGCAAGTGGAGCTGTCCGCACTGTGAGAAGGAGGGGATCCAGTGGGAAGCTAAGGAGGACAATTCTGAGGGTGAGGAGATTCTGGAAGAAGTCGGGGGGGACCCAGAAGAGGAGGATGACCATCACATGGAATTCTGTCGCGTCTGCAAGGACGGCGGGGAGCTCCTGTGCTGTGACACATGCCCTTCTTCCTACCACATCCACTGCCTGAACCCCCCGCTGCCAGAGATCCCAAACGGCGAATGGCTCTGTCCCCGCTGTACTTGTCCAGCTCTTAAGGGCAAAGTGCAGAAGATCCTAATTTGGAAGTGGGGCCAGCCACCGTCTCCCACACCAGTGCCTCGGCCTCCAGATGCTGACCCTAATACCCCGTCGCCCAAGCCCTTGGAGGGGCGGCCAGAGAGGCAGTTCTTTGTGAAATGGCAAGGCATGTCTTACTGGCACTGCTCCTGGGTGTCAGAACTGCAGTTGGAGCTGCACTGTCAGGTGATGTTCAGAAACTACCAGCGGAAGAATGATATGGACGAGCCGCCTTCTGGGGACTTTGGTGGAGATGAAGAGAAGAGCCGGAAGCGAAAGAACAAGGACCCTAAGTTTGCAGAGATGGAAGAGCGCTTCTACCGCTATGGAATAAAACCGGAGTGGATGATGATCCACCGCATCCTCAACCACAGTGTGGACAAGAAGGGCCACGTTCACTATTTAATCAAGTGGCGAGACCTGCCCTATGACCAGGCGTCCTGGGAGAGCGAGGACGTGGAGATTCAGGACTACGACCTGTTCAAGCAGAGCTACTGGAACCACAGGGAGTTAATGAGGGGTGAAGAAGGACGACCCGGCAAGAAGCTTAAGAAGGTGAAGCTACGGAAACTGGAAAGGCCTCCGGAGACCCCAACTGTTGATCCCACCGTGAAGTATGAGCGACAGCCGGAGTATCTGGATGCGACGGGTGGAACCCTGCATCCCTACCAAATGGAAGGCTTAAACTGGCTCCGCTTCTCCTGGGCTCAGGGAACCGATACTATCTTGGCTGATGAGATGGGCCTTGGGAAAACTGTGCAGACAGCAGTCTTCCTCTACTCCCTCTATAAGGAGGGTCACTCCAAAGGCCCCTTCTTAGTGAGCGCTCCTCTGTCCACCATCATCAACTGGGAGAGAGAGTTTGAGATGTGGGCTCCTGATATGTATGTGGTAACCTATGTGGGTGACAAGGACAGCCGTGCCATCATCCGGGAAAATGAGTTCTCCTTTGAAGACAATGCCATTCGTGGTGGCAAGAAGGCCTCGAGGATGAAGAAAGAAGCATCGGTGAAATTCCATGTTCTGCTGACATCCTATGAGTTGATCACCATTGATATGGCCATCTTGGGTTCTATTGACTGGGCCTGCCTCATTGTGGATGAAGCCCATCGGCTGAAGAACAACCAGTCTAAGTTCTTTCGAGTTTTGAATGGTTACTCACTCCAGCACAAGCTGTTGCTAACTGGAACTCCGTTACAGAACAATCTAGAGGAACTGTTTCATCTGCTCAACTTTCTCACCCCTGAGAGGTTCCACAACTTAGAAGGCTTCTTGGAGGAGTTTGCAGACATTGCCAAAGAGGACCAGATTAAAAAACTCCACGACATGCTGGGGCCTCATATGTTGCGGCGGCTCAAAGCTGACGTCTTCAAGAATATGCCATCCAAGACAGAGCTGATTGTGCGCGTGGAGTTGAGTCCTATGCAGAAGAAGTACTACAAGTATATTCTCACGCGGAATTTCGAAGCACTTAATGCTCGAGGTGGTGGCAACCAGGTTTCTCTGCTGAACGTGGTGATGGATCTTAAGAAATGCTGCAACCACCCTTATCTCTTCCCTGTGGCAGCAATGGAAGCCCCTAAGATGCCTAATGGTATGTATGATGGCAGTGCCCTAATCAGAGCATCTGGGAAGTTGTTGCTGCTGCAGAAGATGCTTAAGAACCTGAAAGAGGGAGGGCATCGTGTGCTCATCTTCTCCCAGATGACCAAGATGTTGGACTTGCTAGAGGATTTTTTAGAACATGAAGGTTATAAATATGAACGTATTGATGGTGGAATCACTGGGAACATGCGTCAGGAGGCCATTGATCGCTTCAATGCACCGGGTGCTCAACAGTTCTGCTTCTTGCTTTCCACTCGAGCTGGGGGCCTTGGGATCAATCTGGCCACTGCGGACACAGTTATTATATATGACTCTGACTGGAACCCCCATAATGACATCCAGGCCTTTAGCAGAGCCCACCGTATTGGGCAAAATAAGAAGGTGATGATCTACCGGTTTGTGACCCGTGCATCAGTGGAGGAGCGCATCACGCAGGTGGCAAAGAAGAAGATGATGCTGACACATTTAGTGGTACGGCCTGGCCTGGGCTCCAAGACAGGCTCAATGTCTAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAGCTATTCAAGGATGAAGCCACGGATGGAGGAGGAGACAACAAGGAGGGAGAAGACAGCAGTGTTATCCACTATGACGATAAGGCCATTGAACGACTGCTGGATCGAAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCTCAGTATGTGGTACGGGAAGAAGAGATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATAAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCGAAATCTGGGCAAAGGAAAAAGAATCCGTAAACAGGTCAACTACAATGATGGCTCACAGGAGGACCGAGGTGTGTGTGGCCGGCCCCGCCCCCCACCCACGGGCCGTTCCACTAGAGCAGTGGGCCCCGCTCATCTGCCCTCTCTCCCTCCAGATTGGCAGGACGACCAGTCCGACAACCAGTCCGATTACTCAGTGGCCTCAGAGGAAGGTGATGAAGACTTTGACGAACGGTCAGAAGCTCCCCGCAGGCCCAGTCGCAAGGGCCTGCGGAATGATAAAGATAAGCCATTACCTCCTCTGTTGGCCCGTGTTGGTGGGAATATTGAAGTACTTGGTTTTAATGCTCGTCAGCGAAAAGCATTTCTTAATGCAATTATGCGATATGGCATGCCACCTCAGGATGCTTTTACCACTCAGTGGCTTGTGAGAGATCTTCGAGGCAAGTCAGAGAAAGAATTTAAGGCTTATGTGTCACTCTTCATGCGACATTTGTGTGAGCCTGGGGCAGATGGGGCTGAGACCTTTGCTGATGGCGTCCCACGAGAAGGCCTGTCTCGTCAACATGTTCTCACTAGGATCGGTGTCATGTCTCTGATTCGAAAGAAGGTTCAGGAGTTTGAACATGTTAATGGACGCTGGAGCATGCCCGAACTGGCTGAAGTAGAGGAAAACAAAAAAATGTCTCAGCCAGGTTCACCTTCTCCAAAGACTCCTACACCTTCCACACCAGGGGACACACAACCCAATACTCCTGCGCCTGTGCCACCTGCTGAGGATGGGATAAAAATAGAGGAAAATAGCCTTAAAGAAGAAGAGAGCACAGAAGGAGAGAAGGAAGTTAAATCTACAGCCCCTGAGGCGACTGTGGAGTGTGCACAGCCCCCTGCCCCTGCCCCTGCCACTGCCCCTGCCACTGCCACTGCCCCTG