Transcript asmbl_43428

Sequence
Transcript Sequence for observation asmbl_43428 of TGE0038038:
AGGGAGGCGCACTTCCGGTGCCCTTTCTCCCGCGAGCTCTAAGGCCGCCGATCCTCGTGTGCAAGGCGAGGTCTGTAAGCTGGAGCGGGGCAGAGGCTGGCGGGCACCCCCTCCTGACCGCTGGTGCCGCCGCCGCCGCCTTCGGGAGGATCAGACATGGCCCAGAACTTGAAGGACTTAGCTGGACGCCTGCCCGCCGGGCCTCGGGGCATGGGCACGGCGCTGAAGCTGCTGCTGGGGGCCGGGGCGGTGGCCTACGGCGTCCGCGAATCCGTGTTCACCGTGGAAGGCGGTCATAGAGCCATCTTTTTTAATCGTATTGGTGGCGTGCAGCAGGACACGATCCTGGCCGAAGGCCTTCACTTCAGGATCCCCTGGTTCCAGTACCCCATCATCTATGACATTCGGGCCAGACCTCGAAAAATCTCCTCCCCCACAGGCTCCAAAGACCTGCAGATGGTGAACATCTCCCTGCGTGTGCTGTCCCGACCCAATGCCCAGGAGCTCCCCAGCATGTACCAGCGTCTAGGGCTGGACTATGAGGAGCGAGTGCTGCCGTCCATTGTTAATGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCGCAGCTGATCACCCAGCGGGCTCAGGTGTCCCTGTTGATCCGAAGAGAGCTGACAGAGCGCGCCAAGGACTTCAGCCTCATCCTGGATGATGTAGCTATCACAGAGCTGAGCTTCAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAGCAAGTGGCCCAGCAGGAAGCCCAGCGGGCCCAGTTTTTGGTGGAGAAAGCGAAGCAGGAACAGCGACAGAAGATTGTGCAGGCTGAGGGGGAGGCGGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAATCCTGGCTATATCAAGCTCCGAAAGATCCGGGCCGCCCAGAACATCTCTAAAACGATCGCCACATCACAGAACCGAATCTATCTCACAGCTGACAACCTTGTGCTGAATCTACAGGATGAAAGTTTTACTCGGGGAAGGTAAGTGGCTGCCTCCTTGCTATGGGGTCCTGGGGGCCATCTGCTTCCTGGACCTGCC