Transcript asmbl_43154

Sequence
Transcript Sequence for observation asmbl_43154 of TGE0038006:
GCCGGACGCAGCTAGGCTGTACAGACGCGGGCACGCACACCAGCACGCACGCCCTCCTCTCGTGCGGCCGCGGTCGTTCCCGCGTCCACCAGCAGCGCTGTCGCTTCGGCAGAAATGCTGCGGGCCTGTCAGTTATCCGGCGTGACCGTCGCGGCCCAGAGTTGTCTGTGTGGGAAGTTCGTCCTCCGTCCACTACGACCATGCCGTAGATACTCCACTTCAAGCAGTTCTGGGTTGACTGCTGGTAAGATTGCTGGAGCTGGCCTTTTGTTCGTTGGTGGAGGGATTGGTGGCACTATCCTGTATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATCCCTTACTCAGACAAACTCTTTGGGATGGTTCTTGGTTCTGCGCCTTATACTGTTCCATTACCAAAGAAACCGGTTCAGTCTGGTCCACTAAAAATCTCCAGTGTATCAGAGGTGATGAAAGACTCCAAACTGCCTGTGGCACAGAGCCAGAAAACGAAGGGAGACACTCCAGCTTCAGCAGCATCTACAGGGGCAGCTCAAATTATTTCTGCAGCAGGTGATACACTTTCGGTCCCGGCCCCTGCAGTTCAGCATGAGGACACTATAAAAACCGAATGTCCCAACACTAATGAAGGAAAATCTACGTCTGAAACCACAGCTCTAGCCAAGAGTTTAGAAGATGCTCTGAACCGGACTTCGTCTGTCACTCTGCAGACTATTACAGCCCAGAATGCTGCAGTTCAGGCTGTCAAGGCACACTCCAACATACTGAAAACAGCCATGGACAATTCTGAGATTGCAGGTGAGAAGAAGTCGGCCCAGTGGCGAACAGTGGAGGGTGCATTGAAGGAGCGAAGAAAGGCAGTTGATGAAGCTGCCGATGCCCTGCTCAAAGCAAAAGAAGAGTTAGAGAAGATGAAAACTATAATTGAAGATGCAAAGAAAAGAGAGATTGCTGGAGCCACCCCTCATATAACTGCTGCAGAGGGGAGACTTCACAACATGATAGTTGATCTGGATAACGTCGTCAAAAAGGTCCAGGCTGCTCAGTCAGAGGCAAAGGTGGTATCTCAGTATCATGAACTTGTGGTCCAAGCAAGAGATGACTTTAGAAAAGAGCTGGACAGTATCACTCCAGACATCACTCCTGGATGGAAAGGGATGACTGGCAAACTCTCTACTGATGACCTGAACTCACTCATTGCTCATGCCCATCGTCGCATTGATCAGCTCAACAGAGAGCTAGCACAACAGAAAGCCACAGAGAAGCAGCACATTGAGCTAGCCTTGGAAAAGCACAAGCTAGAAGAAAAGCGGACCTTTGACTCTGCAGTGGCAAAAGCATTGGAGCACCACAGAAGTGAAATTCAGGCTGAGCAGGACAGAAAGGTAGAAGAAGTCAGAGATGCCATGGAGAATGAAATGCGGACCCAACTTCGACGGCAGGCAGCTGCCCACACTGATCATTTACGAGATGTCCTCAAGGTGCAGGAACAGGAACTGAAGTATGAATTTGAACAGGGCCTGTCTGAGAAACTGTCTGAGCAAGAATTAGAGTTTCGTCGTCGCAGTCAAGAACAAATGGACAGCTTTACTCTGGACATAAATACTGCCTATGCCAGGTTGAGAGGGATTGAGCAGGCTGTTCAGAGTCATGCAGTTGCTGAAGAAGAAGCCAGAAAAGCCCACCAGCTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAATGCCTACCATCCCATTGGGGAGTGCAGTTGAGGCCATCAGAGTCAACTGTTCTGATAATGAATTTACCCAGGCTTTAACTGCAGCCATTCCTCCAGAGTCCCTGACCCGGGGGGTATACAGTGAAGAGACCCTAAGAGCCCGTTTCTATGCTGTTCAAAAACTAGCCCGAAGGGTAGCGATGATTGACGAAACCAGAAATAGCCTGTACCAATACTTCCTTTCCTACTTACAGTCCCTACTCCTGTTCCCGCCTAAGCAACTGAAGCCCCCGGCGGAGCTCTACCCTGAAGATATAAATACATTTAAATTGCTCTCATATGCCTCCTATTGTATTGAGCATGGTGACCTGGAGCTGGCAGCAAAGTTTGTCAATCAGCTCAAAGGGGAGTCCAGAAGAGTGGCACAGGACTGGCTGAAGGAGGCCCGAATGACCCTAGAAACTAAGCAGATAGTGGAGATCCTGACTGCATACGCCAGCGCCGTAGGAATAGGAACCACTCAAGTGCAGCAAGAGTAAGGCCTAGGAAGAGTTGTGTAATGTCATATTTCATATCAAAGAAAATCAGCATTGGTATCTGCAGGGTTTGCAACAAGGGTCCCAGAATTGTCCAGAAGTGAGCAGGTTCCAAGTCCTGTGTGAGATGTTAACACCTGTTGCATTTACCGTCCTTACACTGCTATCATGCCAATGAACTCCAGGAGGCTTTATTTGCAACTTGTGTAACACTTCCTGTTTTTTAGGTTTTACTGATCAGGCTTGTGAGCCACTCAAAATAATGTTTGTGATCCCTACTATTGATTCTGCCCTTGGAGCAAACTGAATAAAGCAACACAATGAAAACTGA