Transcript asmbl_11036

Sequence
Transcript Sequence for observation asmbl_11036 of TGE0000067:
CGCAGAGCCCCAATGAATGGGGGAGCCGGAAGCAGGAAGTGAGTTTGCGAACGGAGCAGCTGCTGCAGCAGGGCCCATGGCGGACACCCAGTACATCCTGCCCAATGACATCGGCGTGTCTAGCCTGGACTGCCGTGAGGCCTTCCGCCTGCTGTCACCCACAGAGCGCCTCTATGCCTACCACCTGTCCCGTGCCGCCTGGTACGGAGGCCTGGCTGTGCTGCTTCAGACCTCCCCTGAGGCCCCCTACATCTATGCTCTGCTCAGCCGCCTCTTCCGCGCCCAGGACCCCGACCAGCTGCGCCAACATGCCCTGGCTGAAGGCCTTACCGAGGAGGAGTATCAGGCGTTCCTGGTCTATGCCGCGGGTGTTTACTCCAACATGGGCAACTACAAGTCCTTTGGTGACACCAAGTTTGTTCCCAACTTGCCCAAGGAAAAGCTGGAACGGGTGATCCTAGGGAGTGAGGCTGCTCAGCAGCACCCAGAAGAAGTCAGGGGCCTCTGGCAGACCTGCGGGGAGCTTATGTTCTCTCTGGAGCCAAGGCTTCGACACCTCGGACTGGGGAAGGAGGGAATCACCACCTATTTCTCTGGGAATTGTACCATGGAAGATGCCAAATTGGCCCAGGACTTTCTGGACTCACAGAACCTCAGTGCCTACAACACCCGGCTCTTCAAAGAGGTCGATGGAGAAGGGAAGCCCTACTACGAGGTGCGGCTGGCTTCTGTGCTTGGCTCAGAGCCTTCCCTGGACTCTGAGGTGACTTCCAAGCTGAAGAGCTATGAATTCCGGGGAAGCCCTTTCCAGGTGACCCGGGGGGACTACGCGCCCATCCTCCAGAAGGTGGTGGAGCAGCTGGAGAAAGCCAAGGCCTATGCAGCCAACAGCCACCAGGGGCAGATGCTGGCCCAGTATATAGAGAGCTTCACCCAGGGCTCCATCGAGGCCCACAAGAGGGGCTCCCGCTTCTGGATCCAGGACAAAGGCCCCATCGTGGAGAGTTACATCGGGTTCATCGAGAGCTACCGCGACCCCTTTGGTTCCCGAGGAGAATTTGAAGGTTTCGTAGCTGTGGTGAACAAGGCCATGAGTGCCAAGTTTGAGCGGCTGGTGGCGAGCGCAGAGCAGCTGCTGAAGGAGCTGCCCTGGCCCCCAACCTTTGAGAAGGACAAGTTCCTCACCCCTGACTTCACCTCCCTGGATGTTCTCACCTTCGCTGGCTCCGGCATCCCTGCCGGCATCAACATCCCCAACTACGATGATCTGAGGCAGACGGAAGGCTTTAAGAACGTGTCGCTGGGGAATGTGCTGGCTGTGGCCTACGCCACGCAGCGGGAGAAGCTTACCTTTCTGGAGGAGGATGACAAGGACCTGTACATCCTCTGGAAGGGGCCCTCCTTCGATGTGCAGGTGGGCCTGCACGAGCTGCTGGGCCATGGCAGTGGCAAGCTCTTCGTACAGGACGAAAAAGGAGCATTCAACTTTGACCAGGAAACAGTGATCAACCCAGAGACGGGCGAGCAGATTCAGAGCTGGTATCGGAGCGGGGAGACCTGGGATAGCAAGTTCAGCACCATCGCCTCCAGCTACGAAGAGTGCCGGGCTGAGAGCGTGGGTCTCTACCTCTGTCTCCACCCGCAAGTGCTGGAGATCTTTGGCTTTGAGGGGGCTGATGCGGAGGACGTGATCTACGTGAACTGGCTCAACATGGTTCGGGCCGGGCTGCTCGCTCTGGAGTTCTACACACCTGAGGCCTTCAACTGGCGACAGGCCCATATGCAGGCCCGGTTTGTGATCCTGAGAGTCTTGCTGGAGGCTGGCGAGGGACTCGTTACCATCACTCCCACCACAGGCTCCGATGGGCGCCCAGATGCCCGGGTCCGCCTCGACCGCAGCAAGATCCGGTCTGTGGGCAAGCCTGCTCTAGAGCGCTTCCTGCGGAGACTTCAGGTGCTGAAGTCCACAGGGGATGTGGCCGGAGGGCGGGCCCTGTACGAGGGGTATGCAACAGTCACTGATGCGCCCCCCGAGTGCTTCCTCACCCTCAGGGACACGGTGCTGCTGCGTAAGGAATCTCGGAAGCTCATTGTTCAGCCCAACACTCGCCTTGAAGGCTCAGACGTGCAGCTTCTGGAATACGAGGCGTCAGCTGCTGGCCTCATCCGATCCTTCTCTGAGCGTTTCCCAGAGGATGGACCCGAGTTGGAGGAGATCCTCACACAGCTGGCCACAGCCGATGCCCGATTCTGGAAGGGCCCCAGTGAGGCCCCATCTGGCCAAGCTTGAGGAAGATGTGTGGCCTTGCCCCCAATTCCATCAGACCAAGGCTGCAAGTGGCCCTCCATTCGTGTGTGTATTTAGGGGCTGGGGAGGGGGAGGGGCAGGAGCTTGGACCTTGGTACTACCTCAGCTGAGGGTGGTGACACAACCCCTTCCATTTGTCAGCACTTTCCAGCCTGCCAATTGCTTCCCCTCTGTGATCTCATTTCATCTGCACTGCCATACGTGGAGTGAGCAAGACAGGGCTTACCATCCTGTCTACCAGATGAGGAAATGGCAGTTCTGAGAAGTCACTGGTCTAGATCCCGCAGGTGGCACGTGACAGCTAGGGTTCAAAACGTTCTCACCAAATCCAATGCTCCTCACATATTAATTTTATAACCAGACAAATAAATATTAGAGACAACCACCA