Transcript asmbl_42592

Sequence
Transcript Sequence for observation asmbl_42592 of TGE0001880:
CGGAAGTGGAAGCAAGGCCGGAGCTTTGACCATAAAGCCCAAGGCGGCGGCGTTGGCGGCGGTGTTTGGGGCCGGGCAGCTCCGAGGAGCCTGCTGGAGCCGGAATCGGACGTCTCTGTTGCGGCCTGCGTTGTGTCTCCTCCTCCGTTGACCCTGCGCTTCAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTCATCATCCTGGGGGACTCTGGTGTTGGAAAGACCTCTCTCATGAACCAGTATGTGAACAAGAAGTTCAGTAACCAGTACAAAGCCACAATAGGAGCGGACTTTCTGACCAAGGAGGTGATGGTGGACGACAGACTTGTTACCATGCAGATCTGGGACACAGCCGGTCAAGAACGGTTCCAGTCTCTTGGTGTGGCCTTCTACAGAGGTGCAGATTGCTGTGTTCTGGTGTTTGATGTGACTGCCCCCAACACTTTCAAAACCCTCGACAGCTGGAGAGACGAGTTTCTCATCCAGGCCAGCCCCCGGGATCCCGAGAACTTCCCTTTTGTTGTGTTGGGAAACAAGATTGACCTGGAAAACAGACAAGTGGCCACAAAGAGGGCACAGGCTTGGTGCTACAGCAAAAACAACATTCCTTACTTCGAGACCAGTGCCAAGGAGGCCATCAATGTGGAGCAGGCCTTCCAGACAATTGCTCGGAATGCCCTTAAACAGGAAACAGAAGTGGAACTGTACAATGAATTCCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCCGCAGAAAGCTGCAGTTGTTGAAGGGGCAGTGAGCACAGAGTCCTTCACAGACCAAGAACACACACGTAGGCCTTCAATATGCGTCCCTCCTCCTCCAAACAGACCAGAACGTGAGCTCTCACATCCAGCTGCCAAAAGAAACTCCACCGAACAGTTACCCAACACACACACATACACAAAACACACTCGTGCACACAAAAACACATACACACAACACACACACAGCAAGCAAACTCCAGCCTGTGCCTGTCAGGGCTCCTGGGGCAGCTGCCCGCCTCGTGGGCCCTGTGTATGGCAGGCATATGGCAGAGACCCTGGGTGCTCTGGGGTGCAGTGGGCATGGAAAGCTTACTCTTTTTGTCCACTGGAGAGTGAGAGAACTGTTCACAGTTCATCTGTGTCTAATTATCTGATTTTTTTTTTAACGGTCTTGTGGTCTTTTACCCCTCCCTCCTTGAAGGTCCTGTGGGAAGGCTGGTGCCCAGGCTCCGTTCTGAGCAGGCTGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAATGTATAAATTAGTGTAAGGAATTCCTGGATTGTGTGTTTAAGTCCTCTAACGCAGGCGTGCAAGGTGGAGGGTTGAACCCTGTCTGGATTACAGAGTGTTAGAGACTCAAGTTTGGAAGTCCAGCTAGCGGCAGTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCACAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCTGAAGGGAAAACTGAACTAGACAGTTCCCTTCTGTGTCTAAATTTTCCAAAAGGTTGATTTGCTTAATATAGTAGTGTATACAATGGATAAATTGCTGTTACTTCAAGAATTAAAATTCTCATTTTCTCCCTTTCTGTTTTTTTTCCTTATATTCAACACTTTATGATGCCCTTTTGTCACTATCCTACTCAAAGAGGAAAGGAGAACCCACCAGACCTGTCCCAGTGACTCTACCTTTGTTCTAGAAGGCGCTCCTTTCAGGGTTGTGGTACCTGTAGGTTAGCAGACCCTCCTCCTTTCCCACCCACCCAAGTGTGGCCCAGCACTAACCCACCGTCTCTTGGGTTGAGCCCTGGCAGTTCTGTCCCTTCCCGAGGTCCTGCCCTGCATCATGGCTTGCTTCCTGGAGCACTTCCCCTTCAGAGGTCTACATTCTAGGGTGTAGGCTGAGTTCTTCTGTAAAGAGACGAACGTGATGCCAATAAAATTT