Transcript asmbl_42588

Sequence
Transcript Sequence for observation asmbl_42588 of TGE0001766:
GGCGTGTGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTGAAAATAAACAGCCGCTGCTTTGCGAGTCGCCTTCTTGGTTCTTCGTCCGAGTCTCCTCCGCTGTGGGCAGCTCAGACGCCGAAGACCTAAAAACATATAGTGAATAAGGCACTGCTGGAGTGATTGTTAGGTGAATGCATTTCCAGAGAGATTTTGCCTCCCTCTACTCCCTCCTGACACTCTAACTGCAGCTATGAGCAGCAACGAATGCTTCAAGTGTGGACGATCTGGCCACTGGGCCAGGGAGTGCCCTACTGGTGGAGGTCGGGGTCGTGGAATGAGAAGCCGCGGCAGAGGGTTCCAGTTTGTTTCCTCGTCTCTCCCTGACATCTGCTACCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTGCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAATTGTGGCAAGCCAGGCCATCTGGCTCGTGACTGTGACCACGCGGATGAGCAGAAGTGCTATTCTTGTGGTGAATTTGGACATATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAATTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCATCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCTGTTCCCAGGCCAGTGAGCTTTACTTGCAGTGTAAAAGGAGGAAAGGGGTGGAAAAAACCGAATTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTAATGAATGGGAAGAGTTCAGTCAGACCAGTAAGCCCTTCTGGGTTTGAGTGTGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGCATCTAAGCTTCCATAAATAACTTTAATTCTTAGCATAATGACGGCCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCGAGTAACATCTGCATCAGGCCCTCAGAATATACAGTTGAGTTGGGAGTAAACTGAAAAGACAAATGTGTTGAAGGCTATGCCAGGGAATCTGGCTCAAAGCCTAACACAGAAGCAGCTTCATCCCAGTGACGATGCTGGACGTACAGATGGTGATGGCAAAGGTGTAGAACACATTTTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCCGATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTTGACTAAAGTTCCTTTTGTTTGTTTTAAATTTTCATCAATGTATATAGAACAAAATACCATATTAAAGAGGGGAATGTGGAGGACTGAAA