Transcript asmbl_41945

Sequence
Transcript Sequence for observation asmbl_41945 of TGE0004149:
GGCGGCCATCTTGTTCTTCTCGTGGTTCCCAGTGGCGAGAGGAGGAGGAAGCCCGGAGCGGAGCGGGGCGGCTGGGGGGGGTGGACCCGCCGCGGCTGCTGCTGCCACCGCCGCCGCCGCCACCACCGCTCGTGGGGCTCGTGGCGTGAGGAAGGAGGACGAGTGAGACCCCGGGGCGAGCGGGCGGCGGCGCCGCTGCTGCTGCTGCTGCTGCGGGAGGGTCGGCGGCGGGACGGCGATGGCGGATATCGACAAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCAGGCAAGAATGTCCAGCTCCAGGAGAACGAGATCCGAGGACTCTGCCTGAAGTCTCGGGAGATCTTCCTCAGTCAGCCTATCCTTTTAGAACTTGAAGCACCACTCAAGATATGTGGTGACATCCACGGGCAGTACTATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTCCAGAGAGCAACTATTTGTTTCTCGGGGACTATGTGGACAGGGGCAAGCAGTCCCTGGAGACAATCTGCCTCTTGCTGGCCTACAAAATCAAGTATCCGGAGAACTTCTTTCTTCTCAGAGGGAACCACGAGTGCGCCAGCATCAATAGGATCTACGGATTTTATGATGAGTGTAAAAGAAGATACAACATTAAGCTGTGGAAAACGTTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGTGGACGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGCTATGAGTTTTTTGCAAAGAGGCAGTTAGTCACTCTGTTTTCTGCACCCAACTACTGTGGCGAGTTTGACAATGCAGGCGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTTCCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCCAACGCCACGAGACCTGTCACACCACCACGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCACTTGACACTGCCTGGTTGGGACTTGTAACATAGCGTTCATAACCTTCCTTTTTAAACTGTGATGTGCTGGTCAGCTTGCCCAGGTAGACCTGTCTGTCGGGCCCTCCTCCATTTGATTACTGCTGGCACTTGCTGGTTATAGCAGCAAGCCAAGCACTTCATTCTCAAGAGAGCATTTTGTTTTGAACCTCTGTTCCCTTTGTGGACAGCTCTGATGATGGTGTTAAGCTGTACACCCTGGCAGGTTATCCTGTCTGAGGAGAAAGTGTACAATTGATCTTTTTTTAATTTAGTATAAGTCATGAATAATGTAAATGCCTGTTTTCTTTAGGATATAAAGAGAGCCTTAGAGTGCGTGAGTCTCTACATGTAATTGTCATAAATGCATTCTGTTGATACAAACCACTGTGAACAATTTTTTTTCCAGTTTGTTTGAAAGGGACTGCTTTCCCTCATTGTCTTGTCATGTACAAACTAGTGTCTGCAGCTGTGGCAGCAGGAGTGACCTGCCTGCCGCCAGCCCTGCCCAGACTATCTGAAGCACACTCCTTCCCACTGCACATTTAATAATGATTAAAGCCATTCTTTTCAATGTCTGTGATTCCTTCCTAAAGCCAAAGTTTCTGTTGGACTGTATGGCACGCCCTGGGGATGAGGTGGCCAGGGCATCGAGGCTGCGTGCACAGGCCGCCTCCCTCCGTGGGGCCTCAGAAGCAGGTTATTTTAACTAGCAATAGTGGTATAGTGCTGAGTAAGCTATTAATGATGGAAGTTAATGACACTTTGTACAGTTCCCATATAGTCTATTCACTGAGTGATCTTTTTACAGTTGGATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAACACTGTCCTATACGAGTGACCGATAATGCTTTCTTTGGCTACATTCTTTATTCTGCGGTGACATTGAGGCTTATAAATCAAAAGGAACTAACTTGCCGTCCACCGGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAACTACGACCTGTTAAATGAATCTGTTTGCACAGATGCCCGTGTACAATGCCATGTGCTGAGAATGGTTTCAGACTTATTAAATGCAAGCTTGTTAA