Transcript asmbl_59387

Sequence
Transcript Sequence for observation asmbl_59387 of TGE0006648:
CCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGGTCTGTGGTTTTATATTTATGCTATGCAACGTTTCTCTTCTGACTTTCTGCTTTACATTTAGAACACATCTCAAATTTATCCAGTCATC