Transcript asmbl_59384

Sequence
Transcript Sequence for observation asmbl_59384 of TGE0006647:
CCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGGTTCATGGGACAGAGTTAGAAAACTGGGAATGAATAAGACATCCATAACTACTATTCTTTTTTCACTGTTTTCTAAAATCAAAAAGGGTTTGTAACTTTTTACTGCCCAACTCTTAGATCCTTCATTGAACTGCCTAAAAACGTCTTGTTTTATGAGCCTTCTTCACTAGATGGCAGAGTTTGACATGTTGATATTACGTAGCTGTAGTTTGCAGTTTCTGGGAAGCGATTGAAACACTATTAACCCTGTGTATAGTGTCAACAGTTAAAGCAGACATTGAAATGAAGTAAGCTATATTTCTGGACCGAACAAAGTTCTGCTGTTTAGAGTGTCTAAGTTTGCTTAGTGGATTCATACTCAAAGGAAAGTATAAGCAAATTTCACTTAACAGTGCAAACATGCCTCTGGTGGCAACATGTGGGAATTTGTGGAATTTTTTTTCACACGCAAGTAATGGAGGCTAGAAATGAAGAGAACTTTATTTTTCCCTTGGCTTTGACAGCAAATGCTTAAAATCTCTTCCAAGAAGTGTGCTAAGCTTTTCATTTGGTTCCTGTTAAAGTTGTTCTCACTGACCAGCATGGACTTGGGCAACTGGTGATTATAAGCTATGAGCTCCAGTGCTTATGCCAAAATTATCTTGACAGTAAACCTCTTTTCTTTTCATGTCATACAAAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCATAGCACCTCATTTATCAAGGGTAGGGATTCTGATCATTGAATTATTAGTTAATTAAATTAAATCAGCAGGCAAATAATCATGTTAACTTGACTGCACATCAAGATATTCTACAGCTTATGGAAAAGCATTTTAAAAATGTAACAGGTGGAAAATTACACTGTGCTTAATGACTGATTTTTTTTTAACTGCT