Transcript asmbl_59352

Sequence
Transcript Sequence for observation asmbl_59352 of TGE0006642:
GCCAGCGCAGCCGGTCCGGCCCTGGCGCACGTCGGTAGTCAGCTGCCGCGGCCTGGGGCTGGGATGTGACGGACTGCTGGTCCCGTCAGTGGCGTCTTCCCTGAGCGGCGGTGACTGCGGCGAGGGCGGCGTGGACAAGGCCAGCGGGCGCCATTGGCGACCGGCCGTGTCGGCCGCGGGATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCCCTGCGCCGTCTCGGGCTCGACTTCCTCCGGCTCGGCCGCCGCGGTGCTGGACACCGACTGCAGCCTGAAGCGGAAACTGTGCCTGGCGGGCAGGGGACCGGGCGAGACGCGCAGCGCCGCGGACGCGGACATGAAGCGGGCGCTAGGCAGGCGAAAGGGCCTGTGGTTCCGACTGAGGAAGATACTTCTCTATGTTTTGGGGTTATACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGGATACAGGCCAAACTGATTTTCTTGAATTTTGTGAGGGTTCCCTATTTCATTGACTTGAAAAAACCACAGGATCAAGGTTTGAATCACACCTGCAATTACTACCTCCAGCCAGAGGAAGATATAACCATTGGAGTCTGGCACACTGTCCCCACTGTCTGGTGGAAGACTGCCCAAGGGAAGGACCAGATGTGGTACGAGGATGCCTTGGCTTCCAGTTACCCTATCATCCTGTACCTGCATGGGAATGCAGGTACCAGAGGAGGTGACCACCGAGTGGAACTTTACAAGGTGCTGAGTTCCCTTGGTTACCACGTGGTCACTTTTGACTATAGAGGTTGGGGTGACTCAATAGGCACGCCATCAGAGCGGGGCATGACCTATGATGCACTCCATGTTTTTGACTGGATTAAAGCGAGAAGTGGAGACAACCCCGTGTATATTTGGGGCCACTCCCTAGGCACTGGAGTGGCAACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACACCTCCAGATGCCCTAATATTGGAATCTCCATTCACCAATATTCGTGAAGAAGCTAAGAGCCATCCGTTCTCAGTGATATATCGATATTTCCCTGGATTTGACTGGTTCTTCCTTGATCCCATTACAAGCAGTGGAATTAAATTTGCAAATGATGAAAATGTGAAGCACATCTCCTGCTCCCTGCTCATCTTGCACGCTGAGGATGACCCAGTTGTGCCCTTCCAGCTTGGCAGAAAGCTCTACAACATTGCTGCACCCTCTCAGAGCTTCCGAGACTTCAAAGTTCAGTTTATCCCCTTTCACTCAGACCTCGGCTACAGGCACAAGTACATCTACAAGAGCCCTGAGCTTCCTCGAATACTAAGGGAATTCCTGGGGAATTCGGAACCTGAGCACCAGCACTGAGCTCACTGCTTGAAGGAGCATGAAGACCTTTGCCCTCCTCCCCATTCCTCCAGCCAACCCAGCACCGTGGAGCAAGGGTACCAGCGTCTGTGATGCACCTGGAGAGAGGACTCGGATGCCATCTAGGGCAGGAAGAGGAGGCCACAGCAGACTGGTGGCCAGGAGCATAGATCTTTGTGGAAAATGCGAGTGGCAGGCATGTGGCCCTCTCTCCCTCTTGCTGCCACTCAACCTGAGTTCTTGGAAGGACAGTGACACAGCAGGCAGCAACCAGCAGGTCGATCCCACACTTCTTGAGCTGGGTATGGAGAATGAGGCAGGAAGTATGAAGTCTTGGGACCACACTGAGCTATCCGGTACCACCCATGAGAATGTGAGGACACTTGGGTTCTTCTGTCCCTTCCCAGCACATGCAGAATGGACTCTGTTGGTTCCATAGCCCCTTCCTGCCCTCTGCACCCCCACTTGCCTTCCTTGGTGTCCCTGCCTCCCTTGGCAGGCCCACCACTCACAGAGAGGGAAGTGCCCACGATCTGCACTTCCTCCACTTTCCACCCACCTGTTCACCTGAGCGTTTATTTAATAAAATCCTAGTGGTGG