Transcript asmbl_37921

Sequence
Transcript Sequence for observation asmbl_37921 of TGE0040697:
GAGCTCGGTGCCCGGCCTGGAGGACAGCGGTGTCGCGAGTCGGCGATCGGTGGTCCGCGGCAACGCCGAGAGGCCGTACGGGAACGCGGGCGCCGGAGCTCAGAGGTTGACTCTTCACCACACTGAAGCCGTTAGGAAAACAAACCTTGTGGTTATCAGCAGAGCCTTCAGAGTTTCACCATAACTCAGGCCTAGACATTATTCTAAATGGCAACTGATATGTCTCAAGGTGAACTCATCCATCCTAAGGCACTCCCACTTATAGTAGGAGCGCAGCTGATCCACGCGGACAAGTTAGGTGAGAAAGCAGAAGATACCACCATGCCTATACGTCGAGCCGTGAATTCTACCCGGGAAACTCCACCCAAAAGCAAACTTGCTGAAGGGGAGGAAGAAAAACCAGAAGAACAGGAGAATGAGACTCCACCTGCTACATCCAGTGAGGCAGAGCAGCCCAAGGGGGAGCCTGAGAGTGGAGAGAAGGAAGAGAACAACAACAAGTCTGCTGAGGAACCCAAAAAGGATGAGAAGGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAGACGATTCCTGCCTGGGCGACTCTCTCTGCCAGCCAGCTAGCCAGGGCCCAGAGACAAACCCCCATGGCTTCCTCCCCACGGCCCAAGATGGACGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGACTGGCGCCTCGGTGGTTGCGATTCGAAAGTACATCATTCATAAGTACCCGTCTCTGGGTCTGGAGAGAAGGGGCTATCTGCTCAAGCAAGCGCTGAAGAGAGAGTTAAACAGAGGAGTCATCAGACAGGTAAAAGGAAAAGGTGCATCTGGCAGTTTTGTTGTGGTCCAGAAATCAAAACCACCTCAGAAATCCAAAAACAGAAAGAAGGGCTCGGCTCTGGATCCAGAACCACAAGTAAAACTGGAAGATGTTCTCCCGTTGGCTTTTACTCGGCTCTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATACGTGTCTCAGTATTACCCTAAGCTCAGAGTGGACATCAGGCCCCAGTTGTTGAAGAATGCTCTGCAGCGAGCAGTAGAGAGAGGCCAGCTCGAGCAGATAACTGGCAAGGGTGCTTCGGGGACATTTCAGCTGAAGAAATCAGGGGAGAAGCCCCTGCTGGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAACGAGCCTAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGGCCAACTCTAACTATCAGATGCATTTGCTGAAAAAAACCCTGCAGAAATGTGAGAAGAACGGGTGGCTGGAGCAGATCTCTGGGAAGGGGTTCAGCGGCACCTTCCAGCTGTCCTTCCCCTACTACCCTAGCCCAGGAGTTCTATTTCCGAAGAAAGAATCCGGTGGCTCTGACGATGAAGATGAAGATGACGATGACGATGAATCATCAGAAGACTCTGAGGATGAGGAACCACCACCCAAGAGGAGCTTACAGAAGAAAACACCAGCCAAGTCCCAAGGGAAGACAGCCTCCATGAAGCAGAGAGGGTCGAAGCCTGCGCGGAAAGTCCCGGCTGCCCAGAGAGGGAAAGTGAGGCCGCTGCCTAAGAAAGCTCCACCCAAGGCCAAGACCCCTGCCAGGAAAGCCAGACCCTCTCCCTCAGTCATCAAGAAGCCTAGTGGGAGCTCCTCCAGAAAGCCCATAGCCAGTGCACGAAAGGAAGCGAAACTGCCCGGGAAGGGCAAATCTGCCATGAAGAAGTCTTTCAAGACAAAAAAGTAAATTTTATAGGGAAAAGGGTATCATGATTGAATTCAGAATCTTACTTTATAAGGTCAGTGTGCATTTGTTCTAGTTATAATGCTTTTAAATTGTACTTTTTCTTCCCATGTGAGCATTGTGGGAAGGAATGGACACAGAGCAGCGTAGACATTTGTGAGCTTCGGTGCTGTTCAGTGCCTGCTTCTTCATCACCTTAATTTCTGCCATAACCTGGACTTCGCTGACTGTGTGACTGCCCTGCTCCCTCTGTTCATCTTAGCCCCAGCCCTCGTCCTCTTTCTGTGATCCGATTGAGGATTTTTTCCTCCTTCAAGTTAATTTAAACAACTGCAGAGATGTGTTTGTAGAGCACTTAGAGGTCTGGGGCTGGAAGTCCAGACGGCGCAGGAGCAGTGTTGGGAAGGCTTTGCGTCCTGCCTGCAGACTTGCTAGAGCTGTGGTGATTAACCCTGGCTGTTGAATCACTCCACTGACCAGTCTCCAGCTTGAGTCGGGGACATGTTAACTTCGGAAAGAAGCCCCCGTCCCTGCCATCCCATAGATTCTGAAGGGCTCCTCTCCTCCGGTCACGCTGACCAACTGCCAAGCTCGCTTTGCTGCCCAGAGCACTGTCCCCTCACAGCAAGCACAAGTTGTCTGCACCACTTGGTTTCTGACTGAAGGGGAAGTACAGGACTACATGGAATCTGATTTCTGGTGTTGCTTATTACCAAAAATGACAGAATATTCTTGATCAAATGTCTAGATATATTTTTAATATTTGGGGCATGAGTTGTCCCTGTTTGAGAGTTCCCATTACTAATGTAGAAATGTTAAATGGTAAAACATAATTTGCTAAAATGACCAGTTTTCAGATTCACCTGTGCGTGTGCCCCCCACTCCCATCCCACCCTGTTCTTTCCATAGAACTTTTGATATCAGGCAAACGGTTTCCTTTTTGAGATATTTTAACAGAGAAGGGGTGGGGGAGAAGCAGATGAAGCTGTACTACCCAGCCCTCTTCTTGTTTGTATTTGTTTAGGGTTGTGAGGTTGTGTAAAATAGTACTAGCTTCTTACTTGAGAACTACAGTTTCTGCTTATCATTTATTCTTCCTTGTGGCACTTAATATTTTAATTGTCTTAAGCTTTTTGATGTATATATCCTCTGGCCCCTTACATGCTGCCAGAGGAGAAGGTGTTTGTTTGAGATTCATTCCACTTGAAGTGTCTCCTGGGATCCCCACAGCTGCGTATGGCTGGGAAATGGACTTAAGGCTTGGGCTTGAATTGGTGGCTCCTACCTGTGAGGTCCCATCGTGAGTCACTGGGATTTGTGTTGCATGGAAGGCAGTCTTTCCTGTTGTAAATCTTCCTTTTTTATGTACAAATATTTTGAAAAATATGAATAAACATGAACTTTTAAAAGCTGCTGAACTACA