Transcript asmbl_5912

Sequence
Transcript Sequence for observation asmbl_5912 of TGE0006636:
GGGAACTCGGAGGCGGGGAGCGGCTGTAAGTGGCGGTGGCATTTGGACCCGGCGGAGCTGCAGGCGCGGGAGCCCGAGTGGAGACCGGAGCCCGCGGTGGGCAGCGGCAGCGGGGATGGCGCGGGCAGGGCCGGCGTGGCTGCTGCTGCTGGCGATCTGGGTGGTCCTGCCAGTGTGGCTGTCCTCCACAAAAGTCTCCTCGCTCATCGAGAGGATCTCTGACCCTAAAGACTTGAAAAAACTTCTCAGGACCCGGAATAATGTACTGGTGCTTTACTCCAAATCTGAGGCTGCAGCTGAAAGTCATCTCAGGTTATTGTCCACTGTGGCCCAAGCAGTGAAAGGACAAGGCACCATCTGCTGGGTAGACTGTGGTGATGCAGAGAGTAGAAAATTGTGCAAGAAGATGAAAGTTGACCTGAGCCCAAAGGACAAAAAGGTTGAATTATTCCATTATCAGGATGGTGCATTTCATACTGAATATAACCGAGCTGTGACATTTAAGTCAATAGTGGCCTTTCTGAAGGATCCCAAAGGGCCCCCACTGTGGGAAGAAGATCCTGGAGCCAAAGATGTTGTCCACATTGACAGTGAAAAGGACTTCAGACGGCTCCTGAAGAAGGAAGAGAAGCCGCTCCTGATGATGTTTTATGCCCCCTGGTGCAGCATGTGCAAGAGGATAATGCCGCATTTCCAGAAGGCTGCGACCCAGCTGCGAGGCCACTTTGTACTGGCTGGGATGAACATCTACCCGTCGGAATTTGAAAACATCAAGGAGGAGTACAATGTGCGTGGCTACCCCACCATCTGCTACTTCGAGAAAGGACGGTTTCTGTTCCAGTATGATAACTATGGGTCCACAGCCGAGGACATCATGGAGTGGCTGAAGAAGGTGTGGACACTGTAAGAAAATGAAGCCAGAGTTTGAGAGTGCAGCGGAAGTCCTCCACGGAGAAGCAGGAAGCTCTGGTGTCCTTGCAGCTGTCGATGCCACTGTCAACAAGGCCCTGGCAGAAAGATTCCACATCTCTGAGTTTCCTACATTGAAGTATTTTAAGAATGGAGAAAAATATGCAGTGCCTGTGCTCAGAACAAAGAAGAACTTTATTGAATGGATGCGAAACCCTGAGGCCCCCCCACCCCCAGAGCCCACCTGGGAAGAGCAGCAGACCAGCGTGTTGCATCTGGTGGGGGACAACTTCCGGGAGACACTGAAGAAGAAGAAACACACCTTGGTCATGTTCTATGCCCCTTGGTGCCCACACTGTAAGAAGGTTATTCCACACTTTACTGCTACTGCTGACATCTTCAAAGATGACCGCAAGATCGCCTGTGCTGCTGTGGACTGTGTCAAAGATAATAACCAGGACCTGTGTCAGCAGGAGGCCATCAAGGGCTACCCCACTTTCCACTACTACCACTATGGGAAGTTTGTAGAAAAATATGACAGCGATCGGACGGAATTGGGATTTACCAATTTTATTCGAACCCTCCGGGAGGGAGACTACGAGAGACTAGGGAAGAAGAAGGAAGAGTTGTAATTTCTGCCTCAGAGAAAGCTTTTCCATTACACTGTGAATGATACCTGTTTGGTTGTTCTTTCTGAATTTCCAAGTGTCTGGAGACAAAGTTTT