Transcript asmbl_58240

Sequence
Transcript Sequence for observation asmbl_58240 of TGE0006627:
CCTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGTATGGCATAAATTGATGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA