Transcript asmbl_58129

Sequence
Transcript Sequence for observation asmbl_58129 of TGE0006608:
GAAGGAATCTTATTAATGGACGCGTGAATCGTGCGACATTTAATTAACCAGGTGATGGCAGCCATCGAGATATTGGCCTTAATAAGAAGCCAGGAGTTCGCACGATTTCCCCCGCCTTCATCTTAGGAAAGTGATCAGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAAACTCCCTGTAAACAGGATTTTGTGCTTTCTGTAGTAGTGCATGCTTAAGCACAAAAAAACTCAGCATTGATTACTATAAAGTATATAATTGAGTTTGAGATGAAGCTTTGTAGTCTTCTTGAGTTGGTAAGGAGAATTTCATGAAGGGTAACTGTACAGCTGCTTCTAACAAAACACAGTTTATAATTAACAATTTGAATTATGGCCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTTTATATGTCCTATCATGGACTGTCATCTTTCAGTATTCTTAAAAAGCCAG