Transcript asmbl_58128

Sequence
Transcript Sequence for observation asmbl_58128 of TGE0006607:
TGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAAACTCCCTGTAAACAGGATTTTGTGCTTTCTGTAGTAGTGCATGCTTAAGCACAAAAAAACTCAGCATTGATTACTATAAAGTATATAATTGAGTTTGAGATGAAGCTTTGTAGTCTTCTTGAGTTGGTAAGGAGAATTTCATGAAGGGTAACTGTACAGCTGCTTCTAACAAAACACAGTTTATAATTAACAATTTGAATTATGGCCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTTTATATGTCCTATCATGGACTGTCATCTTTCAGTATTCTTAAAAAGCCAG