Transcript asmbl_3290

Sequence
Transcript Sequence for observation asmbl_3290 of TGE0003685:
AAGCAGAGGAGGAGGCCGAGCCCGCTAGCGCGCAGGCCCAGAAGCTTGCAAGCCGCGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAGTCGGACCGGGCTGGGCTCGCTAAAGGAGAGGCACCGCGGAGGGGCAGGCCAGCGTCGCGTCGCGATCCGGGATGTCGAAGAACACGGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGACGAATATGACGAGAACAAGTTCGTGGACGAGGAGGACGGCGGCGATGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCGTGCCTACGGCAAGGAAACATGACAGCTGCTCTCCAGGCTGCTCTGAAAAACCCCCCTATTAACACAAAGAGCCAGGCAGTGAAGGACCGTGCAGGCAGCATCGTCTTGAAGGTGCTTATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTGCAGTCTCTGGACAAGAACGGTGTGGACCTCCTAATGAAGTATATTTATAAAGGCTTTGAGAGCCCATCTGACAACAGCAGTGCTGTGTTGCTCCAGTGGCATGAAAAGGCCCTTGCTGCTGGAGGAGTGGGGTCCATTGTTCGAGTTTTGACTGCAAGGAAAACCGTGTAGTCCAGCTGGAACTGGACACCGTTCACAGAAGTGGGAGTTGCTGGTATAAAGACCAAAACAACCAAATGGCACCGCTGCCCTGTGGGTAGCATCTGTTTCTCTCAGCTTTGCCTTCTTGCTTCCTTTTTCATATCTGTAAAGAAGAAAATTACATATCAGTTTCCTTTAATGAAAATTGAAATAATGTGGAGAAAATTTTGTCTCAGTGGGGATGTTTGACCCTTTCATAACCATGTCAATAATATGTATCACATTCTGTAATTTATATTCAAGTTTGATTGTGCAATTTCTAACTCTGTTGCCTGGTTTAAGGGTTTTACTTTATTTTTAACCAATACTGAGAGATGTGATCAAAGTTGAGGCCAGTTTCCTAACTCATTGCTGGTCAGGAAGTGATCTTTATTTTTAAAAATGAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCACACTTCCCTTATTTAAGCAAAATGTGTTTCCAGGGCAAGTAGTGGGTGAGCCCTACTACCAGTTTCCAGCCTTCTTTCCGCTTGCCTCCAGATGATGCTATAAGTGTAAGTGTGCTACTTCCTGTTAGCATCCAACTTTCATGGCCTCTCAATCTCTTTGTGGTGACCCAGGGTCCGGAGCAAGGAGTCTTGCTCTATATAAATGTATTTACACAATATAAGCGCCTCTTTGGCACAAACATCCCATTTCCTTCTGGTAATAAGGCTGCCTGGGGAAACAGTCCCAAGTCAGAGACAGGCCTCCAGCAGCCTCTGGATGAAATACTTTCATCAGAAATAAGGTAGCTGCCTTAGCCATTACACAAGTGTTCACTGGAACATTTCCCATGATTTCCCGAGGACGTCTTCAGTGTTCTTCAGGTAATGGGGATCTCAGAAGATTTGGTTCTGATCCAAAGACACAGTCTGTGTTTCAGCTCAGTGTTTTTAAGAAAGAAAAATGCCACATAGTAAAAGAAAAAAAGTGTTTACTTCGTTGGACAAACCAAATTGATTCTCAAAAAATGACCGGTGCTTGTAAAAAGTTATTACAAAGTAGTTCCGAAACCAACCACCTGAATGTGCGTGGCCGAGAGGGAATCAGCCTGCTTGTCTTTCCCTAAGATGCCAACTCCAGAGTCACTGACTGAGGTGAGAACCAGCGCAGAAACTCTATAAACTGCTGTTTTTGATACCTGCTCTTTTTGTTTTGTTCTGTTTTGTAAAATTATGATAAACTTCAGAAAATAAAATGTCAGTGTTGAATAA