Transcript asmbl_32364

Sequence
Transcript Sequence for observation asmbl_32364 of TGE0001954:
AGACGGCTGCAGGGTCCTTGGTGCTGTGGCGGTGTGGTTGATTAGGGTGCTGCTTTCAATCGTGTGGCCTTTGGGAACCCCGCGTAGCCACTGCCGCCTCCTTCTGTCCTCGCCATGTTCCTCACTCGGTCCGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGCATCCAGACCTCAGAGGGTGTATGTCTAGCTGTGGAGAAGAGAATTACCTCCCCACTAATGGAGCCTAGCAGCATTGAGAAGATTGTAGAGATCGATGCTCATATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAAACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTATAATGAGACAATGACAGTTGAGAGTGTGACCCAGGCTGTGTCCAATCTGGCTCTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCTATGTCTCGTCCCTTTGGAGTAGCATTGTTGTTTGGAGGAGTTGATGAGAAAGGACCCCAACTGTTTCACATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCTGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCATAAGTCTATGACTCTGAAGGAGGCCATCAAGTCCTCGCTCATCATCCTCAAGCAAGTCATGGAGGAGAAGCTGAATGCAACCAACATCGAGCTAGCCACGGTGCAGCCTGGTCAGAATTTCCACATGTTCACAAAGGAAGAACTGGAGGAGGTGATCAAGGACATTTAAGAAGGAGCCGTCCTCGAACTTCTGTGGGACACTTTCAGTTCTAATTGCCCTTAGACTTTATTTCCAGCTCTTATGTCATGGAAAATATCCAGTATATGTGTGTGTGTTTTTTTATGAAGTCTGTACATAACAGCAATTCTGAAATAA