Transcript asmbl_27894

Sequence
Transcript Sequence for observation asmbl_27894 of TGE0006790:
CTTAATTTAGCATTATTCACGAAACTACTGCTGAAATGTAAACTAACCTTCCCGGAGCCCTCTTGATTACCTTATCAGAGATGCAATACGTGTAACTTACAAAAGTAAATATATGCTATTGATGTAATAATATTGTGCAGTAGTTTCACTTCAGCGTGATGAATAAATGCCCATCTATCTCTCTTTGTAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAACAGTGCTAACGGCCATGAAGAACGTAGCAAAAAGAGAAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAGAGAAAAAGAAGCAAAAGTAAAGAACGGAAAAGAAGTAGAGATAGAGAAAGGAAAAAGAGCAAAAGTCGAGAGCGGAAACGAAGTAGAAGCAAAGAAAGGAGACGAAGCCGCTCACGCAGTCGGGATAGAAGATTCCGAGGCCGCTACAGAAGTCCCTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGATTGCCTCATAGCATCAAATTAAGCAGAAGACGTTCCCGAAGCAAAAGTCCATTTAGGAAAGACAAGAGCCCTGTGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGACTGTTTTCTGCATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAGATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCATCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGGAAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAATGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACTAGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACCGGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGGCAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACCTCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGCATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATACAGTCCCTTATGTATATAGCTTTTTTTTCTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAACTCCTGTTACCTTGAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTATCCCTAACTAGCAAATCCTACTTTATGCAAAGCTGTTCTCTTGTTCTGCTGTTTTAAATGTCCATGTAGAAAATGACATTAAGGATCTATAGAATAGCTCTAGGGGAACAAATGTGCTTTCTGTATAAAGGCAGACAGGTCACGTTTTAATGTTTCAGAAACCTAACTTTTTACACAGCAGTTACAATTCACATTCATGTATTTGGCTCATGGTTCAGCAAAGGTTTCCAGAATCCACATTTAGTGTGTGAAAAGTCTAAGTGGCTGTATGGCTGCTTGGCATTTGATCTTGATTATTTGGCAAGAATGGGATTTCAAAATAATATTTCTCGATGGTAATTTTTTCAATTAATGTCTCTGTAAAAGTTTCTTTGTAAATACTGTATGTTTTAGTGTGTCTTGAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGGTGGCTGACGTAACAGATTGAGTAAGCAGTCTTGGGCAAGAGATGGGAAATGCAGAAAAAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTGAAAAAGGC