Transcript asmbl_5786

Sequence
Transcript Sequence for observation asmbl_5786 of TGE0006556:
ACATGACTACGTAGACCCGCCCCCCACCCCCTCTGCAGCTGAAGGCTTCCCCTCCGTCAGTGACAGAGCCTTCGGGTGCGTGATCACTTGTGGTTCTGCACCTCGCGCGTTGGCAGGTAAATTAACATGATGGATTTCTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTATGTGCATGGGGTCTCAGGACCTGTCGTTACCGCCTGTGACATGGCAGGTGCAGCTATGTATGAGCTGGTGAGAGTGGGCCACAGCGAGTTAGTTGGAGAGATTATCCGATTGGAGGGGGATATGGCTACTATCCAAGTGTATGAAGAAACCTCTGGTGTGTCTGTCGGAGATCCTGTACTCCGCACTGGTAAACCCCTTTCAGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGATGGTATTCAAAGACCTTTGTCCGATATCAGCAGTCAGACTCAAAGTATCTACATTCCCCGAGGAGTAAATGTGTCTGCTCTTAGCAGAGATATCAAATGGGATTTTACACCCTGCAAAAATCTACGGGTTGGTAGTCACATCACTGGTGGAGATATTTATGGAATTGTCAATGAGAATTCTCTCATCAGACACAAAATCATGTTACCCCCACGAAACAGAGGAACCGTAACTTATATTGCTCCACCTGGAAATTACGATACCTCTGATGTTGTCTTGGAACTTGAATTTGAAGGTATAAAGGAGAAGTTCAGCATGGTCCAAATATGGCCTGTACGTCAAGTTCGGCCTGTCACTGAGAAGCTGCCGGCTAATCATCCTTTGTTGACTGGCCAGAGAGTCCTCGATGCCCTTTTTCCATGTGTACAGGGAGGAACTACTGCAATCCCTGGGGCTTTTGGATGTGGAAAGACGGTGATATCACAGTCTCTATCCAAGTATTCCAATAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGAGGAAATGAGATGTCTGAAGTCCTTCGTGATTTCCCAGAGCTCACTATGGAAGTTGATGGTAAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAACATGCCTGTGGCTGCCAGAGAAGCCTCCATTTATACTGGAATTACACTGTCAGAATATTTCCGTGACATGGGCTATAATGTTAGTATGATGGCTGACTCAACCTCTAGATGGGCTGAGGCCCTGAGAGAAATCTCTGGTCGCTTAGCTGAAATGCCTGCAGATAGTGGATATCCTGCATATCTTGGTGCCCGTCTGGCCTCTTTCTATGAGCGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGAGAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGACCCAGTTACATCTGCTACTCTTGGTATTGTTCAGGTATTCTGGGGCTTAGATAAGAAACTAGCCCAACGTAAGCATTTCCCCTCTGTTAATTGGCTAATCAGCTACAGCAAGTATATGCGTGCCTTGGATGAGTACTATGACAAACACTTCACAGAATTTGTTCCTCTGAGGACCAAGGCTAAGGAGATTCTGCAGGAAGAGGAAGACCTGGCAGAAATTGTGCAGCTTGTGGGAAAGGCTTCTCTAGCAGAAACAGATAAAATCACTCTGGAGGTAGCCAAACTTATCAAAGATGATTTCCTACAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATGCTGTCCAACATGATTGCATTTTATGATATGGCCCGTAGAGCTGTTGAAACCACTGCCCAGAGTGACAATAAAATCACATGGGCCATTATCCGTGAGCACATGGGGGAGATCCTCTATAAACTTTCCTCCATGAAATTCAAGGATCCATTGAAAGATGGTGAGGCAAAGATCAAAGCAGACTATGCACAACTTCTTGAAGATATGCAGAATGCATTCCGTAGCCTTGAAGATTAGAACTGTGATTTCTTTCTTCCTTTTCCTCAGCAAGTTCTCATGTGTGTATATTTTCCTAGATCTCATCTCAGACCCTTTGCTTTTTTATTGTGCAGCTTTGAGATTCGTGCCTATATGTGTTATCATTTCTTTTCCGGTTTATTTGGTAGGTCTTATATAAAGCAAACATTCCTTTGTTCCAGTGTTTGAAGGGCCTCCTTGATCCTTTCTCCAAAGTGGTGAATGTAGTAAATATGATATACTCTGGCTACACTACTGTAAACTTGTGTGTAGAGTCATGTCCCTCCTTGTCCTAGGTTTGCCCTTTCCTTATCGCCATTACATTGTAAACAGGACTACTGCATGTACTTTGCAACAGATTTGGAATGAAAGGCCAGATTTCTATACATTTTGCCAGGTACTTTATAAAGTGACTTGATATCTATCTACATGTCAAGGTTATTTGCAGTTTAGCATTTTACTAAGTAACTGCTTTGCAGGAAATGTTTGCTTTTTTAAAAAAGATGAATGATTAACGTTCCAATTATGCATTGCTTCCCCACTATATATCAGGAATATTTATGGGAAACTGTTGGGGACTATACTGTTTTTAAAAGTCTTTTGTGGGGACTCAGCACAATATATGAATCAGTACCCTCTAAAAAAGTAAAAAAAAGGGGTCAGATGGTCAAATTTAGATTAATGTCATCTTGTTAAACCTTATTTTGTTTCACTAGGAAAATTTCAGTATCAAGGAATAGTCTACCGCATTACTAGGAAATTCTCTTTTAAATTACATTTAGAACAATCACTGAAAACTTAATCCACATCATATCCTTTTCCTTAAACATCTTAGAAGCTTAAGCTTCTAAGAATCATGTGGCAGCGTGATGGGCAATAAAATGTCACAAAGAAGATATTTATTAATGGTTAAAGGCTCTTTGCACCTTTAAGGACCAGCTGAGCTGTACTGATTCTTGGGGCCAGAGTGGCATTATGTTTTTACAAAATGACATGTGTCACATGTTTGCATGTTTGTTCACTTATTGAATTTTTGAACAAGCAGTTTACCAATTGTAGACGTAATATTTTCTTTCATGTGGGTTTTGATTCACTGGCTCAAGAGTTCTCAGAATATCTGTAGCCATAGCAGCTTACCAGTTTCCATTTGGTTTAATAGGGATAAATTAATTTTTGTGTCTGCTGATGGCAGAATCTAGGTCATGTGAAGAAAGATTATTTCGTCCTATCTTTGAAGTATATATTTTAAAATAGTAGTTTCAGTGTTTGTACAATAAGGTACACTGCAGAACAGCTTTGAGAGCAACAGTTTCCCATTAACTTTTTCTGACCCATAGTGCTGGCATCATCGCTTCCTCTTTGGGAAGAGGAAGGGTGTTGAACATATCTAACAATCTCAAATACCTAAATATAATAGCATAAATAAAGTATTTATTTTATGCTTCAGTATGTTATTATTTAAATTTTTAGGTAATGTATTTCTTTTGGTCTGTTAAGGAAAGATGCAGTCAGAGAATTCAGCTGTAGGTTTTTTTAAATCCTTGCAGGTTGATGCTCTTACTGTGGACTACTATTCAGGACAGAGGTTCTTCCATACAACTTTTTGTAACCTTTCAGAGCACTGGAAGATAAAAATTTTACAATGATCTCTTGAGATGTGAATTTAATGGTGCTGCTTAATCAGTTTGCTTTCAGTGTGGCCTCCTGCCCAGAGATCTTAAGACCAGTGGAAATTAAAAGGATTTAAAAACTTTCTATTTCTACCTTAAACTTACCAGCACACTAGGTGGTGATGAATGATATGACAAAGAAAGCTTGACCAAGTTTGTTTTTTTGTCGTTCCAAATTTGCAGTGTACACTCTTACTCTTTTTTAAGAATGTTGATATATGGGTGTGGAGATGCTAGAGAAACTATGCTCAGATATTCAGTAGAAGTGTTCCTTCAGCTATGTTAAGAATTTCATATTGGTCACTGATCATATTTCTTTAGTAAGAATGTGTTAAAATTACCACAGTCTTTTAAAAAGATGATGCAGTTCTATATTTATTGTGCTGTGCCTGGTCCTAAGTGGAGCCAGTTAAACAAGTTTCATATGTATTTTTCCAGTGTTAAGTGTCACACATTGTACCCTTTGGAAATTTCCTGCCATCCCAAGGAATGAATAGAAGAGACCATATATATTGCCTCCATATCCTTGAGATTTCATTATCTTTATGTTAACAGTTGTGTATAATTGTTAAAATCTATGAAAGAATAAAAAGTGGATTTAAATTAA