Transcript asmbl_57761

Sequence
Transcript Sequence for observation asmbl_57761 of TGE0006543:
CGGCTTCCGAGCACAGCATGGCGGTCAAGGTGCAGACAACCAAGCGAGGTGATCCTCATGAGTTAAGAAACATATTCCTGCAGTATGCCAGTACTGAGGTTGATGGAGAACATTACATGACCCCAGAAGATTTCGTCCAGCGCTATCTTGGACTGTATAATGATCCAAATAGCAATCCGAAGATTGTGCAGCTCTTGGCAGGAGTAGCCGATCAAACCAAGGATGGATTGATCTCCTATCAAGAGTTTTTGGCTTTTGAATCTGTTTTATGTGCTCCAGATTCCATGTTCATAGTGGCTTTCCAGTTGTTTGACAAGAGTGGAACTGGAGAGGTGACATTTGAAAATGTCAAAGAAATTTTTGGACAGACTATTATTCATCATCATATACCTTTTAACTGGGACTGTGAATTTATCCGACTGCATTTTGGGCATAATCGAAAGAAGCATCTTAACTACACAGAATTCACACAGTTTCTCCAGGAGCTACAATTGGAACATGCAAGACAAGCCTTTGCACTTAAAGACAAAAGTAAAACTGGCATGATTTCCGGTCTGGATTTCAGTGACATCATGGTTACCATTCGGTCTCACATGCTTACTTCCTTCGTGGAGGAGAACTTAGTTTCAGCAGCTGGAGGAAGTATCTCACACCAGGTTAGCTTCTCCTACTTCAATGCATTTAACTCCTTACTGAATAACATGGAGCTTGTTCGTAAGATATATAGCACTCTAGCTGGCACAAGGAGAGATATTGAAGTCACAAAAGAGGAATTTGCCCAGAGTGCCATACGCTATGGACAAGTCACTCCATTAGAAATTGATATCCTATACCAGCTTGCAGACTTATATAATGCTACAGGGCGCTTGACTTTGGCAGATATTGAGAGAATAGCCCCGTTGGCTGAGGGGGCCTTACCTCACAACCTGGCAGAACTTCAGAGACAGCAATCTCACGGTTTAGGCAGGCCTGTGTGGCTCCAGATTGCCGAGTCTGCTTACAGATTCACTCTGGGCTCAGTTGCTGGAGCTGTGGGAGCCACTGCAGTATATCCTATAGATCTGGTGAAGACGCGCATGCAAAACCAGCGTGGTACTGGCTCTGTTGTGGGGGAGCTGATGTACAAAAACAGCTTTGACTGTTTTAAGAAAGTCTTGCGTTATGAGGGCTTCTTTGGACTCTACCGAGGTCTGATACCACAGCTTATAGGGGTTGCTCCAGAAAAGGCCATTAAACTGACTGTTAATGATTTTGTTCGGGACAAATTTACTGGAAGAGATGGCTCCATTCCACTTTTTGCAGAAATCCTTGCTGGAGGTTGTGCTGGTGGCTCTCAGGTCATCTTTACCAACCCATTGGAGATAGTAAAGATTCGCCTGCAGGTAGCTGGAGAGATCACTACAGGACCCAGAGTCAGTGCCCTGAATGTGCTCCGAGACCTGGGACTTTTTGGTCTGTATAAGGGTGCCAAAGCGTGTTTCCTCCGAGACATTCCCTTCTCTGCAATCTATTTTCCTGTTTATGCTCATTGCAAAATACTTCTGGCTGATGAAAATGGACACGTGGGAGGTCTCAATCTCCTTGCAGCTGGAGCCATGGCAGGTGTGCCTGCTGCTTCTCTGGTGACCCCTGCTGATGTCATCAAGACAAGACTGCAAGTGGCTGCCCGTGCTGGCCAGACGACATACAGTGGTGTCATCGACTGTTTCAGGAAGATACTCCGGGAAGAAGGGCCCTCAGCTTTTTGGAAGGGGACTGCAGCTCGCGTGTTTCGATCCTCTCCTCAGTTCGGTGTTACCTTGGTCACCTATGAACTTCTCCAGCGGTGGTTTTACATTGATTTTGGAGGCCTCAAACCCTCTGGCTCAGAACCAACACCTAAGTCACGCATCGCAGACCTTCCTCCTGCTAGTCCGGATCACATCGGTGGATACAGACTCGCCACAGCCACTTTTGCTGGCATTGAAAACAAGTTTGGCCTTTATCTCCCCAAATTTAAATCTCCTAGTGTTGCTGTGGTTCAGTCAAAGGCAGCGACAGCAGCTCAGTGATGACATAACTGTTGAGTGTGGCAAAACGGCACCCTGGAGAGGCCTAGGACAGCAGCCCTGTAAT