Transcript asmbl_57671

Sequence
Transcript Sequence for observation asmbl_57671 of TGE0006531:
CCGTAACCCACCCCTCTACCCCGTGGCGGCCTCAGGCGACGCCGAGTGAGGCTGAGGCTGGGGGCGAATCGCCGCAGAGCTGCGTGTCGGCATCGCACTCTGATTGGACAGCGGGGAAGCCTGTTAGCTTATTGGCCCCGCTGATCCCGCCCCATAGCGCGGGGCAGCCTTTAACCTTTAGCCCAAGCGGGCGCCAGCCACTCAGATCGCTTCTTGTTGGTATATGCAGCGGCAGTGGCCGCCGGCGGAGCAGTCTGAGCCAGACGATGAGGCCGGGGACGGGAGCCGAACGTGGAGGCCTCATGATGGGGCACCCTGGCATGCATTATGCCCCAATGGGAATGCACCCTATGGGTCAGAGAGCAAATATGCCTCCTGTACCTCATGGAATGATGCCGCAAATGATGCCCCCAATGGGAGGACCGCCAATGGGACAAATGCCTGGAATGATGTCTTCGGTAATGCCTGGAATGATGATGTCTCATATGTCTCAAGCTTCCATGCAGCCTGCCTTACCGCCAGGAGTAAATAATATGGATGTAGCAGCAGGTATGTATGCCATTTGTGGTGAAATCAATGTGGACTGAACATAAATCACCTGATGGAAGGACTTACTACTACAATACTGAAACAAAACAGTCTACTTGGGAGAAACCGGATGATCTTAAAACACCTGCTGAGCAACTTTTATCTAAATGCCCCTGGAAGGAATACAAATCTGACTCTGGAAAGCCTTACTATTACAATTCTCAAACAAAGGAATCCCGCTGGGCCAAACCTAAAGAACTTGAGGATCTTGAAGCAATGATCAAAGCTGAAGAAAGCAGTAAGCAAGAGGAGTGCACCACAGCATCAACAGCCCCAGTTCCTACAACAGAAATTCCGACCACAATGAGCACCATGGCTGCTGCAGAAGCAGCAGCTGCTGTCGTTGCAGCAGCCGCCGCTGCCGCAGCAGCCGCCGCTGCAGCCAATGCCAGTTCTTCCACCTCTGCTTCTAATACAGTGGGTGGAACTGTTCCGGCTGTTCCTGAGCCTGAAGTTACTTCAATTGTTGCTACTGTTGTAGATAATGAAAACACAGTAACAATTTCAACTGAGGAACAAGCACAACTTACTAGTACCCCTGCTGTTCAGGATCAAAGTGTTGAAGTGTCTAGTAATGCTGGAGAAGAAACATCAAAGCAGGAAACCTTAGCTGATTTTACTCCCAAGAAAGAAGAGGAGGAAAGCCAACCAGCAAAAAAAACATATACTTGGAATACAAAGGAGGAGGCAAAGCAAGCATTTAAAGAATTATTGAAAGAAAAGCGGGTACCATCTAATGCTTCATGGGAGCAAGCTATGAAAATGATCATTAATGACCCACGATACAGTGCTTTAGCAAAGTTGAGTGAAAAAAAGCAGGCCTTTAATGCTTATAAAGTCCAGACAGAGAAAGAAGAAAAAGAAGAAGCAAGATCAAAGTACAAAGAGGCTAAGGAATCCTTTCAGCGTTTTCTTGAAAATCATGAGAAAATGACTTCCACAACCAGATACAAAAAAGCAGAGCAAATGTTTGGAGAGATGGAAGTCTGGAATGCAATATCAGAACGTGATCGTCTTGAAATCTATGAAGATGTTTTATTCTTTCTTTCGAAAAAAGAAAAGGAGCAAGCAAAGCAATTGCGAAAGAGAAATTGGGAAGCCTTAAAAAACATACTTGACAACATGGCTAACGTAACATACTCAACTACTTGGTCAGAAGCCCAGCAGTATCTGATGGATAATCCAACTTTTGCAGAAGACGAGGAATTACAGAACATGGATAAAGAAGATGCATTAATTTGCTTTGAAGAACATATTCGTGCTTTAGAAAAGGAAGAAGAAGAAGAAAAACAGAAGAGTTTGCTGAGAGAAAGGAGACGACAGCGTAAAAACAGAGAATCTTTTCAGATATTTTTAGATGAGCTGCATGAACATGGACAACTGCATTCTATGTCATCTTGGATGGAATTGTATCCAACAATTAGTTCTGACATTAGATTCACTAATATGCTTGGTCAGCCGGGATCAACTGCACTTGACCTTTTCAAGTTTTATGTTGAGGATCTTAAAGCACGTTATCATGATGAGAAGAAGATAATAAAAGATATTCTAAAGGATAAAGGATTTGTAGTTGAAGTAAATACTACTTTTGAAGACTTTGTGGCAGTAATCAGTTCAACTAAAAGATCAACCACACTAGATGCTGGGAACATTAAGTTAGCTTTTAATAGTTTACTAGAAAAGGCAGAAGCCCGTGAACGTGAAAGAGAAAAAGAGGAGGCTCGGAAGATGAAACGAAAAGAATCTGCTTTTAAGAGTATGTTGAAACAAGCTACTCCTCCAATAGAATTGGATGCTGTCTGGGAAGATATCCGGGAGAGATTTGTAAAAGAGCCAGCATTTGAGGACATAACTCTAGAGTCTGAAAGAAAACGAATATTTAAAGATTTTATGCATGTGCTTGAGCATGAATGTCAGCATCATCATTCAAAGAACAAGAAACATTCTAAAAAATCTAAAAAACATCACAGGAAACGTTCCCGTTCTCGATCGGGGTCAGATTCAGATGACGACGACAGCCATTCAAAGAAAAAAAGACAGCGATCAGAGTCTCGTTCTGCTTCAGAACATTCTTCTAGTGCTGAGTCTGAGAGAAGTTACAAGAAGTCAAAAAAACATAAGAAGAAAAGCAAGAAGAGGAGGCATAAATCTGACTCTCCAGAGTCAGATGCTGAGCGAGAGAAGGATAAAAAAGAGAAAGACCGGGAAAGCGAAAAAGAGAGAACTAGACAAAGATCAGAATCAAAACACAAATCACCTAAGAAAAAGACTGGAAAGGATTCTGGTAATTGGGATACTTCTGGCAGTGAACTGAGTGAAGGGGAATTGGAAAAGCGCAGAAGGACCCTTTTGGAGCAACTGGATGATGATCAATAAATTATACCAAATATATGTTTACAGTATGGTTTAAAGTCTAATTCAGACCAGGGACTCTATTTTAAGTTCAATGGAAATAACACTGGGTTTTAATTATATCACAGGAGAAAAAAAAAGTGCATTTAAGTATTGTTATTGTGGACTTTATAAAAGCAAAGGAAATTGAAAGTAACTTTCGATTCTGTATCAAGAATCATATTTTCATACAGTCATGTCTTTGTGTCCCTTTCATAGGGCACCGCAGGATGGATTAAAGGTGGCAATTTACTGATAACTGCAAATGTCTCTACTTTGTTCTAAAGTCTAAGTGATGAGGTGATTTGATTTACTTTATAGAAGTTGGATTTTGAAGATATAGTGAAAAATTTTTTGATATCCAGTAGTACAAAAAAAGCACCAGCAACTGATAAAATGGCTTTTTTGTGCACTACCCCAACTGGTTAAAGCTGATCTTTTATGGTGAACCCAGAAATAGGTATTCTTAATGGAAACCTGGTAGACCCTTAACAATAGTGGTGCTAATGAGCACTGCTGTAATAAAGCCACCATTATTTTTTATGAAACATCTGAGTACATTTTAAAAAGGCTATTGTGAGGGCATTATTTTGAGGTGATGTTTAAAAAGTTAACATCAAATCAAATTGTAAATTAGTTTAAATATATTGCCTTAAGGACCTACTAAAGAATGTGCCACCAAACTTTAAGTGATAGTTGCAATATTCTTGTCTAAAACAAAAATCAATGTTGACAAACATTTCTTTAACAGTTGTCTTTTTTTTTTAAATCCGATCTTTCACTTGCTTTTTTTTTCATTGAGGAAGTCTTTTACCTTCCCTACTCACTGAGAAGTATTGACTTCGTGGTACACATTCTAAAGCATTTCTGATTTGAATATTTTTGTACATTTTT