Transcript asmbl_57663

Sequence
Transcript Sequence for observation asmbl_57663 of TGE0006526:
AAAATGTTTTCGTAATTTTTTCTTTAGAAATCAATGTGGACTGAACATAAATCACCTGATGGAAGGACTTACTACTACAATACTGAAACAAAACAGTCTACTTGGGAGAAACCGGATGATCTTAAAACACCTGCTGAGCAACTTTTATCTAAATGCCCCTGGAAGGAATACAAATCTGACTCTGGAAAGCCTTACTATTACAATTCTCAAACAAAGGAATCCCGCTGGGCCAAACCTAAAGAACTTGAGGATCTTGAAGGATACCAGAATACCATTGTTGCTGGAAGTCTTATTACAAAATCAAACCTGCATGCAATGATCAAAGCTGAAGAAAGCAGTAAGCAAGAGGAGTGCACCACAGCATCAACAGCCCCAGTTCCTACAACAGAAATTCCGACCACAATGAGCACCATGGCTGCTGCAGAAGCAGCAGCTGCTGTCGTTGCAGCAGCCGCCGCTGCCGCAGCAGCCGCCGCTGCAGCCAATGCCAGTTCTTCCACCTCTGCTTCTAATACAGTGGGTGGAACTGTTCCGGCTGTTCCTGAGCCTGAAGTTACTTCAATTGTTGCTACTGTTGTAGATAATGAAAACACAGTAACAATTTCAACTGAGGAACAAGCACAACTTACTAGTACCCCTGCTGTTCAGGATCAAAGTGTTGAAGTGTCTAGTAATGCTGGAGAAGAAACATCAAAGCAGGAAACCTTAGCTGATTTTACTCCCAAGAAAGAAGAGGAGGAAAGCCAACCAGCAAAAAAAACATATACTTGGAATACAAAGGAGGAGGCAAAGCAAGCATTTAAAGAATTATTGAAAGAAAAGCGGGTACCATCTAATGCTTCATGGGAGCAAGCTATGAAAATGATCATTAATGACCCACGATACAGTGCTTTAGCAAAGTTGAGTGAAAAAAAGCAGGCCTTTAATGCTTATAAAGTCCAGACAGAGAAAGAAGAAAAAGAAGAAGCAAGATCAAAGTACAAAGAGGCTAAGGAATCCTTTCAGCGTTTTCTTGAAAATCATGAGAAAATGACTTCCACAACCAGATACAAAAAAGCAGAGCAAATGTTTGGAGAGATGGAAGTCTGGAATGCAATATCAGAACGTGATCGTCTTGAAATCTATGAAGATGTTTTATTCTTTCTTTCGAAAAAAGAAAAGGAGCAAGCAAAGCAATTGCGAAAGAGAAATTGGGAAGCCTTAAAAAACATACTTGACAACATGGCTAACGTAACATACTCAACTACTTGGTCAGAAGCCCAGCAGTATCTGATGGATAATCCAACTTTTGCAGAAGACGAGGAATTACAGAACATGGATAAAGAAGATGCATTAATTTGCTTTGAAGAACATATTCGTGCTTTAGAAAAGGAAGAAGAAGAAGAAAAACAGAAGAGTTTGCTGAGAGAAAGGAGACGACAGCGTAAAAACAGAGAATCTTTTCAGATATTTTTAGATGAGCTGCATGAACATGGACAACTGCATTCTATGTCATCTTGGATGGAATTGTATCCAACAATTAGTTCTGACATTAGATTCACTAATATGCTTGGTCAGCCGGGATCAACTGCACTTGACCTTTTCAAGTTTTATGTTGAGGATCTTAAAGCACGTTATCATGATGAGAAGAAGATAATAAAAGATATTCTAAAGGATAAAGGATTTGTAGTTGAAGTAAATACTACTTTTGAAGACTTTGTGGCAGTAATCAGTTCAACTAAAAGATCAACCACACTAGATGCTGGGAACATTAAGTTAGCTTTTAATAGTTTACTAGAAAAGGCAGAAGCCCGTGAACGTGAAAGAGAAAAAGAGGAGGCTCGGAAGATGAAACGAAAAGAATCTGCTTTTAAGAGTATGTTGAAACAAGCTACTCCTCCAATAGAATTGGATGCTGTCTGGGAAGATATCCGGGAGAGATTTGTAAAAGAGCCAGCATTTGAGGACATAACTCTAGAGTCTGAAAGAAAACGAATATTTAAAGATTTTATGCATGTGCTTGAGCATGAATGTCAGCATCATCATTCAAAGAACAAGAAACATTCTAAAAAATCTAAAAAACATCACAGGAAACGTTCCCGTTCTCGATCGGGGTCAGATTCAGATGACGACGACAGCCATTCAAAGAAAAAAAGACAGCGATCAGAGTCTCGTTCTGCTTCAGAACATTCTTCTAGTGCTGAGTCTGAGAGAAGTTACAAGAAGTCAAAAAAACATAAGAAGAAAAGCAAGAAGAGGAGGCATAAATCTGACTCTCCAGAGTCAGATGCTGAGCGAGAGAAGGATAAAAAAGAGAAAGACCGGGAAAGCGAAAAAGAGAGAACTAGACAAAGATCAGAATCAAAACACAAATCACCTAAGAAAAAGACTGGAAAGGATTCTGGTAATTGGGATACTTCTGGCAGTGAACTGAGTGAAGGGGAATTGGAAAAGCGCAGAAGGACCCTTTTGGAGCAACTGGATGATGATCAATAAATTATACCAAATATATGTTTACAGTATGGTTTAAAGTCTAATTCAGACCAGGGACTCTATTTTAAGTTCAATGGAAATAACACTGGGTTTTAATTATATCACAGGAGAAAAAAAAAGTGCATTTAAGTATTGTTATTGTGGACTTTATAAAAGCAAAGGAAATTGAAAGTAACTTTCGATTCTGTATCAAGAATCATATTTTCATACAGTCATGTCTTTGTGTCCCTTTCATAGGGCACCGCAGGATGGATTAAAGGTGGCAATTTACTGATAACTGCAAATGTCTCTACTTTGTTCTAAAGTCTAAGTGATGAGGTGATTTGATTTACTTTATAGAAGTTGGATTTTGAAGATATAGTGAAAAATTTTTTGATATCCAGTAGTAC