Transcript asmbl_57654

Sequence
Transcript Sequence for observation asmbl_57654 of TGE0006524:
ATCAGTTTCCTTCTCTCATTGAGAAAGAAGAGGATTGGAAGGCCGAGCGTATAAAGCCGCGCAGAGAGCGTGAAACAAAGCAGTCGGATCGGAATTGGACTTGGGGTGCGCCGTGTGGAGTCAGGCATAAAACTTGTTGGAGGGGAGTAACGAGCCTGCTCCTCCAGCTCTCCTCATCTGTGCGGGTTCCCACCAGCCTTGCGATTTATTTTTATATCTGCTTTTTTTATATATAGAGAAATATATATACATATATATTTTTTTCCCCATAAGAGAAAATTTCTGTTCCAAGAGAAAATAAGGCAAGATCAATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGTAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGAGACAGTCAGTGTGGGAAAACCGCGCTGCTGCATGTCTTCGCCAAAGACTGCTTCCCCGAGAATTACGTCCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTATTATGACAACGTCCGGCCCCTCTCTTACCCAGATTCTGATGCCGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACTCTAGACAGTGTCCTAAAAAAGTGGAAAGGTGAGATCCAGGAGTTTTGCCCCAACACCAAAATGCTCATGGTTGGCTGCAAATCTGACCTTCGGACAGATGTTAGTACATTAGTAGAACTCTCAAATCACAGACAGACACCAGTGTCTTATGATCAGGGGGCAAACATGGCCAAACAGATTGGAGCTGCCACTTATATTGAATGCTCAGCATTACAGTCGGAAAATAGCGTCAGAGACATTTTTCATGTTGCCACTTTGGCATGTGTAAACAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGGGCCACAAAGCGGATTTCACATATGCCCAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGTTGCACCGTGATGTGAATCTCCCGTTATCTTTAATGAGGACAAGGAAATCTAGTGTAAAAAAACACCACAACAAAACAAAAAGGTGAAGTCTGAATGAAGTGCACAGCCAAAGTCACATATTCTGGAGGCTTAGGAGGCATTTGAAAGGATGCTCATCTTTTTGGAATCCTGTCCTTAGGTTCGGCATGTAGAACAAGTGGTGAAAAGTGAATACATTGAAGTGTTCTGAAGTGTGACTTGAAAAATATGCCAAAAAAGAGAGATTCAGATGGTCTAGAGGTAGATGAGGAGGAATGCGAGTACCTCCAAGAAGAAAAATCCCGCTCTGAATGGTGCTTGTGTTATCGTTTTCTTTGTTGTAATCTATTCATGAATCTCTACTTTGATTTAATTTTTAAATGTTTTAATCTCCTTTACAAAAAGTATATATTAATATACCGTCCTCATTGGGGAACTGGCACTGTGACCTTAGCATTTAGTTTTCTAGAGGATGTGATCTAATTTCCTCCTAGCTCATCATTAAAATGGAAATTATATCAGGACCCATGGGATATCCAGAGGAAAAGTTTGTGAGGCTTTGAAATCTTGCCTTCCTGAAGAGAGCTGAGCGAGATGGTTCTAAAGAAAGGCTTTTGCGGTCTTGCAAGATATGCAGACGGGCACTACAAAGATCGAATAGATTGAATAGAAAAATGGTGTCGATTTTTATTCAGTCTGATGGTTCTGTTCATCATTGTGATTGTCATTAAAAAGTGGTAAATTGCTCAATGTAATATTTTTGTGCGCTGTTTAGAAAAGAGGGTTGTGATTTTTTTGCCATCGTTGATGAAAATGCAAAGTCAAATAAAAGGTGTCTTGGTTTGGTGTCATAGAATGATCCAAGGGGAAAAAAATGTAGGTACTATTTTCACCTGAAGAGATAAGGAATGAAGGAATAGTAGCAGAAAGCACAGTTTGTGAGTAAGCGGTCTGGAATTAACTTACCAAAAGTACAAAGCAAAAGGCCTATTGTTTGGGAGGTGAAGCTCTAAAGCTGGCAGCATCTGATGATCTGTTGGTTTATTTCGTTTTACTTAAATGAACATGACAAGAGAGGGATCCTCTTGTCCAAGCCTTAGAGAATTTTTAGAGAGAAATTATGTAATGTCCATTCTGACACTATGCTAGCCGTTTCTAAAGAGTGATTGCTAAACCTCACTTAACCAGATTCTGCCAAGGCCCGTGTTCAATACTTGATTGCAGTTACATAAAATAATCAACATTTAAAATAGTTTACAGATATTTTTCGACCAGTTCCTTTTAGAGTTTCTTTCAGAGAAGAAACCAGATCTGACCTGTTTATTGTTGGCGCTTGTTGAAAACGAGCTTTCTTTCCAATGATAAAGCTTCATTTTTGAAGTGTTGAAGCTGTGCTCCCATTAAATTGTGGCAGGAGAGGAGATTAAGATAATTACAACACTTAGTTCTATGTCTTACAAGCACTTTGTTTTGTCTCTGCAAGAAAATACCATTCCAGCCATTTCTCATGAAATAACAGACGTTTTACCAACATAATATGCTTTGACTGATGCAGCATTATGCTTTGGGCAGTATTACAAAATAGCTGGCAAGTGCTTTCTGTATTTAAATATTGTAAAAAGAAAATAAGTTATAACTGTTATAAAGCAGAACTTTCGTTGCATTTTTTAAAATGTTGAAGTCAGTTTGTATGTTTGGTCAATGTTTCCGCAGTATTTATTAAAACATACTTTTTTTTCTTCAAATAAAAAAG