Transcript asmbl_21318

Sequence
Transcript Sequence for observation asmbl_21318 of TGE0032516:
CTTCCCTCCTCCTCACACCGGCGCTGGCTTATGGGATGCGCAGGCGCAGAACTCTCCCAGCAGAAAGCCCTCGGAGCCCGGGGGCCGGGCGCGGGGCCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCGTCGCACCGTCTGTCTTTGTGTTTCAAAAGGACAAAGGACAGAAGAGATCTGCTGGCAGCTCCAGTCCCGAAGCCGGAGAAGATTCTGACCATGAGGATGGAAACTACTGCCCCCCTGTCAAGCGTGAGCGGACATCCTCTCTAACTCACTCAGAAGAGAAGAGCAGCGGCTTCCGGCTGAAGCCCCCAACACTCATCCACGGTCAGGCACCCAGTGCAGGTCTGCCCAGCCAGAAACCCAGGGAACAGCAGCGTGGTGTGCTCCGTCCAGCTGTGCTGCAGGCCCCTCAGCCCAAGGTGCTGTCGCAGACGGTTCCCAGCAGTGGCACCAATGGAGTCAGTATGCCAGCAGACTGCACGGGGCCAGCAACGTCTGTATCACCAGAAAACCTCACGCAGAGGAGTCCCTCTGAGTCTGCCGAGGAGACACACACACTCGAGGAGAAGGTGCCTCAGAAAACCCCACATGGCACCTCAGAGGAGGGGCACTGTGAAGAGGAGCAGGCGGCCCCACAGGCCTTTGTGTTTGGACAGAACTTGAGAGACAGAGTGAAGTTAATGAATGAGAATGCCAGCGTGGCAGATGTAGACAGTGCTGCACATCCCAGCTCAGAAACACCCTCTGCGACCAACTACTTCCTTCAGTACATCAGTTCCAGCGCAGACAACGCGACCCACAGTGCTGACAACTCCACCAAGTTTGTGTTTGGCCAGAACATGAGTGAGCGCGTCTTGAGCCCCCCAAAGCTGAATGAAGCCAATTCAGACACCAGCAGGGAGACTACACATGCCCAGTCAGGTTCTGAGTCGTCATCCCAGGAGGCCGCCCCCAAGAAAGAGTCCCTGGCAGAGTCAGCCGCTGCCTATACAAAGGCTACAGCGTGGACGTGTTTGCTGGAGAAGGTGGAGGTCATCACGGGGGAGGAGGCAGAGAGCAATGTGCTGCAGATCCAGTGTAAGCTGTTTGTGTTCGATAAGACCTCACAGTCATGGGTGGAGCGTGGCCGGGGACTTCTCAGGCTCAATGACATGGCGTCAACCGACGATGGCACATTACAGTCCCGGCTAGTGATGCGGACCCAGGGCAGCCTGCGGCTCATCCTGAACACGAAGCTGTGGGCACAGATGCAGATGGATAAGGCCAGTGAAAAGAGCATCCGCATCACAGCCACCGACGCTGAGGACCAGGGTGTCAAGGTTTTCCTGATCTCGGCCAGCTCCAAAGACACAGGCCAACTGTATGCTGCACTGCACCACCGCATCCTGGCTCTGCGTAGCCGGGCTGAACAGGAACAGGAGGCCAAGGCGCCCCCACCTGAGCCAGGAGCCACCCGGGCCACCGAGGAGGAAGACAGTGATGAGGATGCTGTTCTGGCTCCCTCCGGTGTCACGGGGGCTGGCACAGGTGATGAAGGAGATGGCCAGGCTCCTGGGAGCACATAGCGGCGGAGCCACTGCACCAGGCTGCTGCTTTGTTGTCTGTCTGCTGCCCGTCCCTCCCTGCAGGCCGCATCATGGTGGTGTCTATTGCCGGGGTGGCCACAGGCTGGATCCGAGTGTCCCCTCTGCAGCAGACGGGGACGCCAGGATGCGGCTTGGGACTCAGACCTCATCATATTGATGAGTAGAAAGAACGTTCCCCCGCCCTCCTCCGATCGAAATGGCACATTGACACTTGTCACAGCTTCGTGGTGACCGTCCATCCCTGGGCAGCAACAAAGAGAACTCCAGGCTCAGCATTCTGTTGAGTAACTTGCTACCTGCTCGGCTTTCCACTCTGCCAGGTCCACATGGCAGGTGCCTCTCCTTCATTTCTGGTGGCTTGGCTCTTGAGGTCACAGATGAAGCTACACGTGGGCTGAGCTGACTTGATGCTCCTATGGGTGGTGCCCGGCCCCCACGGGGGTTCACTAGGTTTGGGCCTGAGAACACCTGTCTGGACAAAGGTGATGAAACCAAGAGAGCTCCTGCCTTCTTGCCTGCCTACGTGAACCACCTGGGTCTCCCTTAGCAGGTACCCAGCCCTGAGGTGACTGACCACCTAGGGCCCCTGAGAG