Transcript asmbl_57576

Sequence
Transcript Sequence for observation asmbl_57576 of TGE0006510:
CGGGTGCCCGAGCTCGGAGCGCGCAGGTGAGCGTGCGAGTTCGAGCGGCCAGACTGCATTTTGTCGGCATTGTGTCGCTTTCTTTTTCTTTTTGAATTCCTGGTTTGCAGACAGCAATGGCAGCCCGAGTACTTGTAATTGGCAATGGAGGAAGAGAACATACACTGGCTTGGAAACTTGCACAGTCTGATCATGTTAAACAGGTGTTGGTTGCCCCAGGAAATGCAGGCACTGCCTGCTCTGAAAAGATTTCAAATGCTGCCATCTCCATCAGTGATCACAGCGCCCTTGCTCAATTCTGCAAAGATGAGGAAATTGAATTTGTAGTTGTTGGACCAGAGGCACCTCTGGCTGCTGGAATTGTTGGGAACCTGACATCTGCAGGAGTGCGATGCTTTGGCCCCACAGCAGAAGCGGCTCAGTTAGAGTCCAGCAAAAGATTTGCCAAGGAGTTTATGGATCGACATGGAATCCCAACTGCACAATGGAGAGCTTTCACCAAACCTGAAGAGGCCTGCAGCTTCATTATGAGTGCCAGCTTCCCTGCTTTGGTTGTGAAGGCCAGTGGTCTTGCAGCTGGGAAAGGGGTGATTGTTGCAAAGAGCAAAGAAGAGGCCTGCAAAGCTGTACAGGAGATCATGCAGGATAAAGCTTTTGGAGCAGCTGGAGAAACAGTTATCATTGAAGAACTTCTTGAAGGAGAAGAAGTGTCTTGTCTGTGCTTCACTGATGGAAGGACTGTGGCCCCCATGCCCCCAGCACAGGACCATAAGCGATTGCTAGAAGGAGATCACGGCCCCAACACCGGGGGAATGGGAGCCTATTGCCCAGTACCTCAGGTTTCTAAGGATTTGTTGCTAAAAATTAAAAATATCATTCTTCAGAGGACAGTGGATGGCATGCAGCAAGAGGGTACGCCATACACAGGTGTTCTCTATGCTGGTATAATGCTGACTAAGGATGGCCCAAGAGTTCTGGAGTTTAATTGCCGTTTCGGTGATCCAGAGTGCCAAGTCATCCTCCCACTTCTTAAAACTGATCTTTATGAAGTGATTCAGTCTACCTTAGATGGCCTGCTGTGTACCTCTCTGCCTGTTTGGCTTGAAAATCACACTGCTATAACTATTGTCATGGCAAGTAAAGGTTATCCAGGAGACTACACCAAGGGTGTGGAGATAACAGGGTTTTCTGAGGCTCAGGCTTTGGGACTGGAGGTGTTCCAAGCAGGTACTGCCCTAAAAGATGGCAAAGTGGTGACTAATGGTGGTAGAGTCCTTACAGTAACAGCCATCCAGGAAAATCTCATCTCAGCCCTTGAAGAAGCCAAGAAAGGACTAGCTGCTATAAAGTTTGAGGGAGCCATTTACAGAAGGGACATCGGCTATCGTGCCATAGCTTTCCTTCAGCAGCCCAGGGGCCTGACTTATAAGGAATCTGGGGTAGACATTGCAGCTGGAAATATGCTGGTCAGGAAAATTAAACATTTAGCAAAAGCCACCTCTAGACCAGGCTGTGATGTTGATCTTGGAGGTTTTGCTGGTCTTTTTGATTTGAAAGCAGCTGGTTTCAAAGATCCTCTTTTGGCCTGTGGAACAGATGGTGTTGGAACAAAACTGAAGATTGCCCAGCAGTGCAATAAACATGATACCATTGGTCAGGATTTGGTTGCAATGTGTGTAAATGATATTCTGGCACAAGGAGCAGAGCCCCTCTTCTTCCTTGATTACTTTGCCTGTGGAAAACTTGACCTCGATACAACTGAAGCAGTTGTTGCTGGAATTGCTAAAGCCTGTGGAAAAGCTGGATGTGCTCTCCTTGGTGGCGAAACAGCAGAAATGCCTGACATGTATACTCCAGGAGAGTATGACCTAGCCGGTTTTGCCGTCGGTGCCATGGAGCGGCATCAGAAACTCCCTCATCTGGAAAGAATCGCCGAAGGGGATGTTGTCATTGGAATAGCTTCATCTGGTCTTCACAGCAATGGGTTTAGCCTCGTGAGGAAAATTGTAGCGAAATCTTCCCTTCAGTACTCCTCCCCAGCACCCGATGGCTGCGGTGACCAGACATTAGGAGACTTGCTTCTAACTCCAACCAGAATCTACAGCCATTCACTCTTACCTGTATTACGTTCAGGACACGTCAAGGCCTTTGCCCACATTACTGGTGGAGGATTGCTAGAAAACATCCCCAGAGTCCTCCCTCAGAAATTTGCGGTGGATTTAGATGCCCAGACCTGGAGGATCCCCAGGATCTTCTCGTGGTTACAGCAGGAAGGACAGCTGTCTGAAGAAGAGATGGCCAGAACATTTAACTGTGGGGTTGGGGCTGCCCTCGTGGTATCAAAGGACGTGACAAAGCAGATTCTGAAGGATATTCAGCAGCACCAGGAAGAAGCTTGGGTGATTGGCAGGGTGGTGGCATGTCCTGAAGGTTCTCCTCGTGTGAAAGTCAGGCACCTAATCGAAGCCATGCAGATAAATGGATCAGTATTGGAGAATGGCACCCTGAAAAGCCATTTCACTGCCCAACCAAAAAAGGCAAGAGTGGCTGTCTTAATATCTGGAACAGGATCCAACCTCCAAGCTCTGATAGACAGCACTCGGGAGCCGAGCAGCTGTGCACACATTGTTGTCGTCGTCTCCAACAAAGCAGCGGTGGCTGGCTTAGATAAAGCAGCGAGAGCTGGAATTCCTACCAGAGTAATTAATCATAACTTATATAAAAGTCGTGTAGAATTTGACACTGCAATTGACCAAGTCCTTGAAGAGTTCTCCACAGACATAGTCTGTCTCGCAGGATTCATGAGAATTTTATCTGGCCCCTTTGTCAGAAAATGGAATGGGAAAATGCTCAACATCCACCCTTCCTTGCTCCCTTCTTTTAAGGGGTCAAATGCCCACGAGCAAGCCCTGGGTGCCGGTGTCAAAGTAACTGGGTGCACGGTGCACTTTGTAGCTGAAGAAGTAGATGCTGGACAAATTATTTTGCAAGAAGCTGTTCCTGTGAAGAGGGGTGACACTGTTGCAACTCTGTCTGAAAGAGTGAAATCAGCAGAGCATAAAATATTTCCCGCAGCCCTCCAGCTGGTGGCCAGTGGAACTGTGTGGCTTGGAGAAAATGGCAAACTCTGTTGGGTTAAGGAGAAATGAAGCTGCCTAATTCAGGAATGGAGCCAGTTTTGAAAGAAGTCTAGCTGTTTACATGGTG