Transcript asmbl_20971

Sequence
Transcript Sequence for observation asmbl_20971 of TGE0003604:
CACGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTGAGCGCGGGCCTCCCTCCCGGGGCAGGGCGAGCATCCCCGGCCATGGCGACCCTGGCTCACAGCTCCCCTCTCGCTCAGGTTTCTGGAGACGGTGGAGCTGCAGATCAGCCTGAAGAACTACGACCCTCAGAAGGACAAACGTTTCTCGGGCACCGTCAGGCTCAAGTCCACCCCACGCCCCAAGTTCTCGGTGTGCGTTCTGGGGGACCAGCAGCACTGTGATGAAGCCAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTCAAGAAGCTTAACAAAAACAAGAAGTTGGTCAAGAAGCTGGCTAAGAAGTACGATGCCTTTTTGGCCTCTGAGTCTCTGATTAAGCAGATCCCACGTATCCTGGGCCCAGGCCTAAACAAGGCTGGCAAGTTCCCCTCCCTGCTGACACACAATGAAAACATGGTGGCCAAAGTGGATGAGGTGAAATCGACAATCAAGTTCCAGATGAAGAAGGTGCTGTGTTTGGCCGTCGCTGTTGGCCACGTGAAGATGACCGATGATGAGCTAGTCTACAACATTCATCTGGCTGTCAATTTCTTGGTGTCCTTGCTTAAGAAAAACTGGCAAAACGTGCGGGCTCTGTACATCAAGAGCACCATGGGCAAGCCCCAGCGTCTGTATTAGGATGCTCCAATAAACCTCACTGCTGCCACTCA