Transcript asmbl_57566

Sequence
Transcript Sequence for observation asmbl_57566 of TGE0006507:
GTGGCTGCAGGTATTGAGGGGAGTGACGATGATGCTTTAGTAACTGGAGAACAGGATGAAGAGCTCAGCCGATGGGAACAGGAGCAGATAAGAAAAGGAATTAATATTCCTCAGGTTCAAGCAAGTCAGCCTACTGAAGTGAATATGTACTACCAGAACACTTACCAGACAATGCCTTACGGTTCATCCTATGGCATTCCTTATAGTTATACAGCCTATGGATCATCCGATGCCAAATCTCAAAAATCAGATAATACAGTCCCTTTCAAAACTCCCAGTAATGAGATGACTCCCGTTACTATTGATTTGGTAAAGAAACAGCTTAAAGACAGGTTGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACT