Transcript asmbl_19553

Sequence
Transcript Sequence for observation asmbl_19553 of TGE0031446:
GCCTGTCTTTTCAGTCGGGCGCTGAGTGGGTTTTCGGATCATGTCTGGTGGCTCCGCGGATTACAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAGAATTTAAAATTAAAACGTATAAATTGTCCTAGTCCTGTGAGAGCCCCCATTTTAATTGTCCATGCATGCAGGGAGTTTTGTTGAAAGCTAAGCAGGAAATGGGTATTGTAGGTATGACTTTAGGGATTGATTGCACCTCAACAGTTAAACCCATAGGTTTCTCAGGGTGGATTATATCTGTACCCATTTAAAATTTGGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTAAACATTTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCACTGCTATATTGGCTTTGAAGTAATACTTCCTGATGAAGCTGCAAGCTTTATTCGGGTCAAGATTATAAGGCTCAGTGCCTTGTGGGAAAAAATACCAATATTTGCCCTTAAAAGCATTTCACTACACAGTGGAGAATGTAGAAATTGATTATTTACGTTCCTAGTTGGTGTTTGAGGTAACAAGGTCCCAAGTTTAAAAAGAGGAGGGAGCATTAAGTTTAAGGTGAATTTTAAGCTTGAAATTAGTAAATTTTGTGCTATGCATGCATAAAAGCTGTTGGCATATATAATAGTGCAATTATGCCTTTAAGCTTAGTCTTAGACCTAGGTTTTATAGAATAACTACCATTTTTGGCTTTTAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGATTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCCAAGGCATTTTGTATGTTAGCATTTCTGATAGGGAGTGATAGGTGGTTTGTATTGTCTGGTACTTTGTAGGAAGGTAGAGAGCTGTTTTGGAGGTAACACGTTTGAGTAATTTGAGTATATAACGTGTGAAAAGAAGCTGAGCAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATACTTGCTTTCACACTGGAAAAAAAGTAAGTTTTAGAAAATAGTTAACCTTGCAGCATTTGTATTTACAGTTCCAGAAGTGCGTCGAAATGGATTGTATAACTGTTTTCTTTTATTCCTGGTGTTTACATTTGTCCCAGGCTGACAACTGCTCCTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACCCCAAACACAATACTGTCATCTGCTTTATTGTAATGCTCAAGGCGCCTATCTCATTTTGCAGCCAGACAAGCCTTGAATTCTTTTGGTGGCACTATCTGCAAAGGAAGATGTTTTTCCACCTGGATATTGGTTTTATCAGCTAGTGCTCCACTTAAAAGCACGAACTATAATCCTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCGTCATATTCAGTAGCTTTAAATAGTACTAAAGTAACTTGCTGACTGTTGGTTTCTTTCTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTTA