Transcript asmbl_193

Sequence
Transcript Sequence for observation asmbl_193 of TGE0032174:
GTGCACACAAGACGAACAGATGGGACCTTTGTCACTCAGAATAAAGAAGCAGGAAGTGTAATATCTGCCCGGAGAAAGGAGTATTAAAAGCAGATATGAGACCCTAAATGCGGTACTTGATGTGTGCGGGCTGGGCGCTGGTGGAAATCGAACCTCGTGGTATGTTCTGTAGGAACCTGAGGGAGCTAACTGAAGCCTAGCTCCTGCTGCGCTTGCGGCGCAGTCTACCTTAGAGCTGCTTGATTATCAACGCACACATTTTCGTGGAGAAGTCTCGTGTGTATATTCAGCCATGGCACAACTCCAGGCACGTTTCTACAGCGAGAACAAGAAATACGCAGTGGATGATGTCCCTTTCTCAATCCCTGCCGCTGCTGAAGTTGCGGACCTTAGTAACATTATCAATAAGTTGCTGGAGACCAAAAATGAACTCCACAAGCATGTCGAGTTTGATTTCCTTATCAAGGGCCAGTTTCTTCGAGTGCCCTTGGTCAAACACATGGAACTGGAGAACATTTCATCGGAAGAGGTTGTGGAACTAGAATATGTGGAAAAGTACACCGCACCCCAGCCAGAGCAGTGCATGTTCCATGATGACTGGATCAGCTCAATTGAAGGGGCAGAAGAATGGATCCTGTCTGGTTCTTATGATAAGACTTCTCGGATCTGGTCCTTGGAAGGAAAGTCGATAATGACAATTGTGGGACATACAGATGTTGTGAAAGATGTGGCTTGGGTGAAAAAAGACAGTTTGTCCTGCTTACTACTGACGGCCTCGATGGACCAGACTGTTCTCTTATGGGAGTGGAATGTAGAGAAGAACAAAGTGAAAGCTCTGCACTGCTGCCGAGGGCATGCTGGGAGTGTGGACGCCATCGCAGTCGATAGCTCGGGAGCTAAGTTTTGCAGTGGCTCCTGGGATAAGATGCTAAAGATCTGGTCTACAGTCCCTACAGATGAAGAAGATGAAATGGAAGAAGCCACAAATCGACCAAGAAAAAAGCAAAAAACAGAACAATTGGGACTAACAAGAACACCCTTGGTGACCCTCTCTGGCCACACAGAAGCAATTTCCTCAGTCCTTTGGTCAGACGCTGAAGAAATCTGTAGTGCATCTTGGGATCACACAATTAGAGTGTGGGATGTTGAGTCTGGCGGTCTTAAGTCAACTCTGACAGGAAATAAAGTGTTTAATTGTATTTCCTATTCTCCCCTTTGTAAACGTTTGGCATCTGGAAGCACAGACAGGCATATTAGACTGTGGGATCCCCGAACTAAAGATGGTTCTTTGGTGTCGCTGTCTCTCACCTCACACACAGGCTGGGTGACATCAGTGAAGTGGTCTCCTACCCATGAACAGCAGCTCATCTCGGGCTCTTTAGATAACATTGTGAAGCTATGGGATACAAGAAGCTGTAAGGCTCCTCTCTACGATCTAGCTGCTCATGAAGACAAAGTTCTAAGTGTGGACTGGACAGACACAGGGCTACTTCTGAGTGGAGGAGCAGACAATAAATTGTATTCCTACAGCTATTCCCCTACCACTTCCCATGTGGGGGCTTGAAAATGAATGGCTGAGAAGAGACTTCCTTGTTGGGTCTTGTCTTAATTCTTAGTGTCTCACTGTTATTTCATAAACTGAATCAAATTTGAGAGAGGACTTATAGTACAGCTCAGCTGGTAGAATGCTTGCCTAAAATGTGCACAGCCCTGCATGCTATCTCCAGCACTGCCCAAAGAAAAATGGGCATGGTAGCACATTCCTGTAATCCCAGTCCTAGAGGTTGGAAGCAAGAGCATCAGAAATTCAAGGTCACCCTCTGCTGTATAGTGAGCTTAAAGGCAGCCAGCCATGGTTCCCTGAGTCTCTGTCTCCATAAGAAAGAAATCAATGGATAATCCTCTGATATCATTGTCAATGCAGAGACAGGAAGCAGCCTTTTAAAATTTGGATAACAGTTCATCTTTCATAATAGCAACATTTTACTGTCTTT