Transcript asmbl_18672

Sequence
Transcript Sequence for observation asmbl_18672 of TGE0045043:
GGCATCCTACATCAATCAGGAAGCTGCTGTCCAGCCATGGAGGGAGAGGAGAAGCCAGCTCAAGAGCTGATGTGGATGCCTTCAACTTGCTCCTGGAGATGAAACTGAAACGACGGCGTGAACGCCCCAACCTTCCACGTACAGTGACCCAGCTAGTGGCCGAGGATGGGAGCAGGGTGTATGTGGTGGGCACTGCTCACTTCAGTGATGATAGCAAGAGAGATGTAGTAAAGACTATCCGGGAGGTGCAACCGGATGTGGTCGTGGTGGAGCTCTGTCAGTACCGGGTGTCCATGCTCAAGATGGACGAGAGGACGCTGCTGCGAGAGGCCAAGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCTGTCAGGCAGAATGGGCTTATGTCTGGACTCATGCAGATGTTGCTGCTGAAGGTGTCTGCTCACATCACTGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAAGAGGCCAGCAAGGTACCATTCTGCAAATTCCACCTGGGTGACCGACCAATCCCAGTCACCTTTAAGAGGGCCATTGCTGCACTCTCCTTCTGGCAGAAAGTCAAGCTGGCCTGGGGCCTGTGCTTCCTGTCAGACCCAATCAGCAAAGACGACGTGGAGCGCTGCAAACAGAAGGACCTGTTGGAGCAGATGATGGCCGAGATGATTGGGGAGTTTCCTGACCTGCATCGCACCATTGTCTCAGAGCGTGACGTCTATCTGACCTATATGCTGCGGCAGGCCGCACGGCGCCTTGAGCTTCCCCGCGCCTCTGATGCTGAGCCCAGGAAGTGTGTCCCGTCTGTGGTTGTGGGCGTCGTTGGCATGGGGCATGTGCCTGGCATTGAGAAGAACTGGAGTACCGACCTCAACATCCAGGAGATCATGACAGTCCCCCCACCGTCCATCTCAGGCAGAGTGTCCCGGGTGGCTGTGAAGGCGGCCTTCTTTGGTCTCCTGGGCTATAGCCTGTACTGGATGGGCCGTCGGACCCTGAACCTGGTCCTGTCACTGCCTGCTGCACAGTTCTGCCTCCAGAGGGTGAGCGAAGCCCGGCCAGGCCGGTAGGAGGACCGTGCAAGGAAGAGACTGCACCTGGGGGCTCTGCTCTGCGCCGAGTGGGGTGCTCACGAGGAGCTGGCGCCGCCCGTCTGGGGATGTCCCTGGGGACAGATGCATCCAAGCCACCCCCTATGGGGGCCTAGGCCAGGCTTTCCCTGCCTTCCCAATGCCCAGCCCACCCAAATAAAGAATATTTAACTGTCTGAGCCCAGGCTTCCCAGCAGCCCACACACACACTGTGGGGCCACCTATGGGCATCAGGGCCAACCGCAGTGTCAGGACCCAGCGGCCTAGTTCCAAAAGGACCAGAAACTGAGGGGGAGGCACTGAGACACCCCACCCTTAACCCCAGGTGGGTTTGGCAAGCTGTTGCTCTACCTACCTCACTGTGCCTTGTGCTCTGGCCGGCAGGAGCATCTGGGCCTGAGTGCATCTCACTGTGGGTTTGGGGCTGAGTGGCCATGCACCTCCCTCCTGGGTGTGTGGGGCCTGGCCTGGCCTGGACATGCATGTGGCATTGCCAGCTGCATCTCTGCCTGCAGAGAGTCTGGTTTTGTGGGGTTTTGTTTTCTGTTTTTGTTTTTGTTTTTTAATGTCAAAAAGTTTTTTACTCAGGTAATTTTGACGTCAAAGAGAAAACAAACTGAAGCAAATATCAGGAAATACAAGCCTTAAATCCAGTGAGGACAAAGAAGTCATCTTTTTATTTGTGTTTGTGTGCCCTGAGTGGGCAGTGTGTGTCAGAGTCGGCTTGGGGGTCCAGGCCAGCCCCTGCTAGACACCACTACAGCTCAGAGTGGCGTGGGGCTGCCTCAGATATGAGCCTGCAAGGCTGCCCTTGGTGTTGGTAGGACCTTAGCCTGATTGCTGTGCATTAGGTGAGAGGCCCAAACTGCACTGAGGGCAGTAGGCACCCACTATGGGCCACGGCTGGTTTGTGTGCAGCCAGCCATTCATGTGTACAGGCTGTGGCTCCTAGTATATGGCACAGCCTGGCAAGACCTAGACCACATTGATTGTCCTTGTGTTGGCTGCCAAATCAGGTGAGACACGGAGCTGGGTGGGGACACAGGGCTGGCTGGCTGTGTACTCTGTCTCACACTTGTGGACTCATTCCCTAGAAAGAAATAAATTTTAATTTTGGAA