Transcript asmbl_18669

Sequence
Transcript Sequence for observation asmbl_18669 of TGE0036304:
CCCAGCCCGTCAGCCCGGCGACGCGCGCATGGAGGCCGGCTGAGGAGCGCCGCCGCCTCTCTCGGCATCCTACATCAATCAGGAAGCTGCTGTCCAGCCATGGAGGGAGAGGAGAAGCCAGCTCAAGAGGCTGACGTGGAACCTGTGGTAACAGCAGGCACCTCAGAAGCAGTGCCAAGGGTGCTTGCTGGAGACCCTCAGAACATCTCTGATGTGGATGCCTTCAACTTGCTCCTGGAGATGAAACTGAAACGACGGCGTGAACGCCCCAACCTTCCACGTACAGTGACCCAGCTAGTGGCCGAGGATGGGAGCAGGGTGTATGTGGTGGGCACTGCTCACTTCAGTGATGATAGCAAGAGAGATGTAGTAAAGACTATCCGGGAGGTGCAACCGGATGTGGTCGTGGTGGAGCTCTGTCAGTACCGGGTGTCCATGCTCAAGATGGACGAGAGGACGCTGCTGCGAGAGGCCAAGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCTGTCAGGCAGAATGGGCTTATGTCTGGACTCATGCAGATGTTGCTGCTGAAGGTGTCTGCTCACATCACTGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAAGAGGCCAGCAAGGTACCATTCTGCAAATTCCACCTGGGTGACCGACCAATCCCAGTCACCTTTAAGAGGGCCATTGCTGCACTCTCCTTCTGGCAGAAAGTCAAGCTGGCCTGGGGCCTGTGCTTCCTGTCAGACCCAATCAGCAAAGACGACGTGGAGCGCTGCAAACAGAAGGACCTGTTGGAGCAGATGATGGCCGAGATGATTGGGGAGTTTCCTGACCTGCATCGCACCATTGTCTCAGAGCGTGACGTCTATCTGACCTATATGCTGCGGCAGGCCGCACGGCGCCTTGAGCTTCCCCGCGCCTCTGATGCTGAGCCCAGGAAGTGTGTCCCGTCTGTGGTTGTGGGCGTCGTTGGCATGGGGCATGTGCCTGGCATTGAGAAGAACTGGAGTACCGACCTCAACATCCAGGAGATCATGACAGTCCCCCCACCGTCCATCTCAGGCAGAGTGTCCCGGGTGGCTGTGAAGGCGGCCTTCTTTGGTCTCCTGGGCTATAGCCTGTACTGGATGGGCCGTCGGACCCTGAACCTGGTCCTGTCACTGCCTGCTGCACAGTTCTGCCTCCAGAGGGTGAGCGAAGCCCGGCCAGGCCGGTAGGAGGACCGTGCAAGGAAGAGACTGCACCTGGGGGCTCTGCTCTGCGCCGAGTGGGGTGCTCACGAGGAGCTGGCGCCGCCCGTCTGGGGATGTCCCTGGGGACAGATGCATCCAAGCCACCCCCTATGGGGGCCTAGGCCAGGCTTTCCCTGCCTTCCCAATGCCCAGCCCACCCAAATAAAGAATATTTAACTGTCTGAGCCCAGGCTTCCCAGCAGCCCACACACACACTGTGGGGCCACCTATGGGCATCAGGGCCAACCGCAGTGTCAGGACCCAGCGGCCTAGTTCCAAAAGGACCAGAAACTGAGGGGGAGGCACTGAGACACCCCACCCTTAACCCCAGGTGGGTTTGGCAAGCTGTTGCTCTACCTACCTCACTGTGCCTTGTGCTCTGGCCGGCAGGAGCATCTGGGCCTGAGTGCATCTCACTGTGGGTTTGGGGCTGAGTGGCCATGCACCTCCCTCCTGGGTGTGTGGGGCCTGGCCTGGCCTGGACATGCATGTGGCATTGCCAGCTGCATCTCTGCCTGCAGAGAGTCTGGTTTTGTGGGGTTTTGTTTTCTGTTTTTGTTTTTGTTTTTTAATGTCAAAAAGTTTTTTACTCAGGTAATTTTGACGTCAAAGAGAAAACAAACTGAAGCAAATATCAGGAAATACAAGCCTTAAATCCAGTGAGGACAAAGAAGTCATCTTTTTATTTGTGTTTGTGTGCCCTGAGTGGGCAGTGTGTGTCAGAGTCGGCTTGGGGGTCCAGGCCAGCCCCTGCTAGACACCACTACAGCTCAGAGTGGCGTGGGGCTGCCTCAGATATGAGCCTGCAAGGCTGCCCTTGGTGTTGGTAGGACCTTAGCCTGATTGCTGTGCATTAGGTGAGAGGCCCAAACTGCACTGAGGGCAGTAGGCACCCACTATGGGCCACGGCTGGTTTGTGTGCAGCCAGCCATTCATGTGTACAGGCTGTGGCTCCTAGTATATGGCACAGCCTGGCAAGACCTAGACCACATTGATTGTCCTTGTGTTGGCTGCCAAATCAGGTGAGACACGGAGCTGGGTGGGGACACAGGGCTGGCTGGCTGTGTACTCTGTCTCACACTTGTGGACTCATTCCCTAGAAAGAAATAAATTTTAATTTTGGAA