Transcript asmbl_5730

Sequence
Transcript Sequence for observation asmbl_5730 of TGE0006490:
GAAACAGGTGTTATTACCCCAGAAGAGTTTGTGGCAGCTGGAGATCATTTAGTCCACCACTGTCCAACATGGCAATGGGCTACAGGAGAAGAATTGAAAGTGAAGGCATACTTACCAACAGGCAAACAATTTTTGGTCACCAAAAATGTACCATGCTACAAGCGGTGCAAACAAATGGAATATTCAGATGAATTGGAAGCTATCATTGAAGAAGATGATGGTGATGGAGGATGGGTAGATACTTACCATAACACAGGTATTGCAGGAATAACCGAAGCAGTTAAGGAGATTACACTGGAAAGCAAGGACAGTGTAAAACTCCAAGATTGCTCAGCCTTATGTGAGGAGGAGGAAGAGGAGGATGAAGGAGAAGCTGCAGATATGGAAGAATATGAAGAGAGTGGATTGTTGGAAACAGATGAGGCTACCCTTGACACAAGGAAAATAGCAGAAGCTTGTAAAGCTAAAACCGATGCTGGAGGTGAAGATGCTATTTTGCAAACAAGAACTTATGACCTTTACATCACTTATGATAAATATTACCAGACACCACGACTATGGTTGTTTGGCTATGACGAGCAACGTCAGCCTTTAACAGTTGAGCACATGTATGAAGACATCAGTCAAGATCATGTGAAGAAAACAGTGACCATTGAAAATCACCCTCATCTCCCACCACCTCCTATGTGTTCGGTTCACCCGTGCAGGCATGCTGAGGTGATGAAGAAAATCATTGAGACTGTTGCGGAAGGAGGGGGAGAACTTGGTGTTCATATGTATCCTTACCTGCTTATGTGATTAATGGCAAATTGGCCCCTAAGATTTTTTTTTCCTTTTTGGGAAATTTAGTGTAACCTTAATGGCACAGTACCTATAACTTATTTTAGCCCCTCA