Transcript asmbl_18141

Sequence
Transcript Sequence for observation asmbl_18141 of TGE0000137:
GTTCGCCGCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGGAGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGAGAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAGGGTCAAGTCCTCCATACCAAGGACCAGGCTAAAACCAGATTACACTGCCCCTCCCTGGGCCCTATTGACTTAAAGCAGCCACTGTAATCATGGGCAATATCTTTGGGAACCTTCTGAAGAGCCTAATCGGCAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCTGCCGGGAAGACCACCATCCTCTACAAGCTGAAACTCGGGGAGATTGTCACCACCATCCCGACCATTGGGTTTAATGTGGAGACAGTGGAATATAAGAATATCAGCTTCACAGTCTGGGACGTAGGTGGCCAGGACAAGATTCGGCCCCTCTGGAGACACTACTTCCAGAACACCCAAGGCTTGATATTTGTGGTTGACAGCAATGATCGGGAGCGAGTGAACGAGGCCCGGGAAGAGCTGATGAGGATGCTGGCGGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTGTTTGCAAACAAACAGGATTTGCCGAATGCTATGAATGCTGCTGAGATCACAGACAAGCTGGGGCTGCACTCCCTGCGTCACCGCAATTGGTACATTCAGGCCACCTGTGCTACCAGCGGGGACGGGCTGTATGAAGGCTTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTCTCTGACTACCCCACCCACTCCTGACACACACCTGCTGTCTCCTTACCCCAATTTTCCCTTCTTCCTCTTGAAAGTGGCCAAGGTCCTGGGTATCATGTCCACATGCCCAGCAAGCGCCTTGCCTTCCTCCTCCTCCTCCTCCTCCCTCCTCCCTCCTCCCTCCCTGTACACTGACACGGTCAGCCCCCAACTGCTGTCCTGATGATGAATCATTCCAATTTACTGGATTTAAAACAGAATGAAGCTGTTACGGTTTCGTGGGGTGGTCCCCATTGGTTTCAGGAGGAAGAGTGGGGTGTTCTCTGTTTGCTGTTTGGCACTGGTTGCTGTGCTCTTGGCATCTGAGTCCCTTCCCTGTGTCCCTGGCCACTCTCCTCCCTGTCTTCCTTTCCTTCTGAACCCTCTCCTATTCTACATGGACATTGCACGGGCCTCTCTGTGTGTGCGTGCATGTGTGCGCCTGTATATATGTGTATAGAGAGATATATATGTAGGGTCAGGGGAGGGAGCACAGCGCAGCTCAGGGCTTACAGCCGGGACACTGCGCACTGGAACCTGTCCCCTGCCCTTCTGTGTTGGTGAGATAAGGGGATGTGGGTGGGTCCCGTTGTTTTCCTCTCTGCAGGTGGCATTCCTGGATGTTGGGATACATGATGGGCGCCTTCGGCCATCTGTCTTACCTTTCCTTCTCCACTATGATGAGCACACGAAGTGGCATTGGTCTCTGGGTGACTGTTCCTAAGGAGCTGCCGTGCTACTCTGCCTCATTAGTAGCCCACTCACGCTATCAGTCTAGAGTGTTGTATTGATCCTCCCCCACCGTCCTCAGATCTGCTCCTCAGGAACTCAGAGGGAGGTGGGTTAGTGGGACCTGCATGTAGAGGTGGACAGTGGTCGGGGAAGGCCTAGTTTTCCATCTTACTGTCATAAGGAGGAGAAGGTAAGGCATGGAGCAGTCCTGTTCCTGCCTTCTGGTCTGTCAGAGATCTTTCCCCTTAGTAGTTCTGCTGGCCTGATGAGGACTGACCAAGTGGAGTAACGAGAAGCCATGGACTGGGGGTAACATAGCCGACCTCAGTATCAACTCCCTGTTCTTCAGTTCTCTGTCTAGTTCAGGACCAGGAAAGATGAGTTTCTGTTGTCCTCGATGTCCTGTCCCCCTCCTTCCTGGCAGCTTTCCCCAGTCCTCACCCTGTCCTGAATAGGTCTGTGGGGTTGGAGTAGATGCCGTAGGACCCTGCATGGCTGAGCCTGGAACTGTGATCTTCAGGGCCCTCCCTCCCTCCATCCTCTGCTTGTTCAGCTGCTGCTGCAGGTCTGTAGAGGGCGCCTATTCCAGAAGATCTGACCTGGGTCCTGACTTGTCACTGCACTGAAGCTGTGGCTGTTCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCAAAACAGCTGCCCATAACCTCTCTGCTAAGGTCAGGACCCTGGGCTCTCTGCAGCTTGGCCAAGGGACTCTTCCCAGAGGCCTGTTCTGAGTTCCTCCACTCAGTGGCCAGGTTTCTTGCCACCTTTGTCTATAGCAGGCAGATAGGTTCCCCAGCCTACCGTCAGCTGAGCTGTGCGAGGTTCCAGGATGTCTCTCAGTGCAAGTAGTGCTGTGATACCCCAGACACCATGTGAGCGTGTGCTCTAGACCTGGTGTGTGTGAGTGTGTGTGT