Transcript asmbl_17921

Sequence
Transcript Sequence for observation asmbl_17921 of TGE0036243:
GTCTCACAGGAAATTCTCAGCTCCCAGGCATGGGTCCTTGGGCTTCCTGCCTCGCAAGCGCAGCAGCCGGCATCGTGGGAAAGTGAAGAGCTTCCCTAAGGATGACGCTTCCAAGCCCGTTCACCTCACAGCCTTTCTGGGTTACAAGGCTGGCATGACCCACATCGTCCGGGAAGTTGACAGGCCAGGATCTAAGGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAAACTCCCCCAATGGTGGTTGTGGGCATTGTGGGATATGTTGAGACCCCACGAGGCCTCCGGACCTTCAAGACTGTATTTGCTGAGCACATCAGCGATGAGTGTAAAAGGCGCTTCTATAAGAACTGGCACAAGTCTAAGAAGAAGGCTTTCACCAAGTACTGTAAGAAATGGCAGGATGACACAGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGCATGAAGAAGTACTGCCAGGTCATCCGCATCATTGCCCACACTCAGATGCGTCTGCTTCCTCTACGCCAGAAGAAGGCACACTTGATGGAGATCCAGGTGAATGGAGGCACTGTGGCTGAGAAGCTCGACTGGGCCCGAGAGCGGCTGGAGCAGCAGGTTCCTGTGAACCAGGTGTTTGGGCAGGATGAGATGATTGATGTCATTGGCGTGACAAAAGGCAAAGGGTACAAAGGGGTAACCAGTCGTTGGCATACAAAGAAACTGCCCCGAAAGACCCATCGAGGTTTGCGCAAAGTTGCCTGTATTGGAGCCTGGCACCCTGCCCGTGTTGCCTTCTCTGTGGCTCGAGCTGGGCAGAAAGGCTACCATCACCGAACAGAGATTAACAAGAAGATTTACAAGATTGGTCAAGGCTACCTCATCAAGGATGGCAAACTGATCAAGAACAATGCATCTACTGACTATGACTTGTCTGACAAGAGCATCAACCCACTGGGTGGCTTTGTGCATTATGGTGAGGTGACCAATGACTTCATCATGCTCAAAGGCTGTGTGGTGGGGACCAAGAAGCGAGTACTTACTCTTCGTAAGGTGAGACTGATCCTGGGCTCTAACCAGTCATTCTGGGCATGGGGGATCACAGGCCTTGAGCTATGCGGAAATTGGCCTGTCTGGGTATTGAAATCCTGGGGAAGGGTGGACTTTGCATTAGCCTTTTACCCACTCTGTTCTGTGTCAGTGTGGTGGCTGTTTGAGCGGGTGCTAAGTATTTGAACGCTGCTTGTCAGCTGCTAAGCATTCTTTTTGGCCCATAGTCCTTGCTGGTTCAGACCAAACGTCGGGCCCTGGAGAAGATTGACCTGAAGTTCATTGACACCACCTCCAAATTTGGCCATGGTCGCTTCCAGACCATGGAGGAGAAGAAAGCATTTATGGGACCACTCAAGAAAGATCGCATTGCCAAGGAGGAAGGAGCTTGATTCCAGGACCACTTTGTGCAGATGGTGGGGTCTCACCAATAAAATATTTCTACT