Transcript asmbl_17906

Sequence
Transcript Sequence for observation asmbl_17906 of TGE0032237:
ATTTTGTGCAGTTGCTGGGAAGGAAGGGAGACGCCTCAACCGTGGCACCGCCCGGTTTGAGCGGGACCAGACCTCCCGACTGTCCTAACAACCCCGATTCTCTGAGTTGTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGACAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCGCCATCGGTCATCACTAGACCCGAGCCGCAGGCCCTCCCGAGCTCGGTCATCCGTGCCCCGCTCCCAGATCTTTATCCGTTTGGGACCATGCGTGGAGGCGGCTTTGGGGATCGGGATCGTGACAGGGACCGTGGAGGGTTTGGAGCAAGAGGTGGTAGTGGGCTTCCCCCTAAGAAGTTTGGTAATCCTGGGGAGCGGTTACGAAAAAAGAAGTGGGATTTGAGTGAACTCCCTAAATTTGAGAAGAATTTTTATGTTGAGCATCCAGAAGTAGCAAGACTGACTCCGTATGAGGTTGATGAGCTACGGCGTAAGAAAGAGATTACAGTGAGAGGGGGAGATGTTTGTCCAAAACCTGTCTTTGCCTTCCATCATGCTAACTTTCCACAGTATGTGATGGATGTGCTGATGGATCAGCACTTTACAGAACCCACTCCCATTCAGTGCCAGGGATTTCCTTTGGCTCTTAGTGGCAGGGATATGGTTGGCATTGCACAGACTGGCTCTGGGAAGACATTGGCGTATTTGCTGCCTGCGATTGTTCATATAAACCACCAGCCATACTTGGAAAGAGGAGATGGTCCAATTTGTCTAGTGCTGGCTCCTACCAGAGAGCTTGCGCAGCAGGTGCAGCAGGTGGCTGACGATTATGGAAAATGCTCCAGGTTGAAGAGTACGTGCATTTACGGAGGTGCTCCTAAAGGTCCCCAAATTCGAGACTTGGAAAGAGGTGTTGAGATTTGCATAGCCACTCCTGGGCGCCTAATAGATTTCCTGGAGTCAGGAAAGACAAACCTTCGCCGATGTACTTACCTTGTGTTGGATGAGGCTGACCGGATGCTTGATATGGGCTTTGAGCCCCAGATCCGTAAAATTGTTGATCAAATCAGGCCTGACCGGCAGACACTGATGTGGAGTGCAACCTGGCCGAAGGAAGTGAGGCAGCTTGCAGAGGATTTCCTGCGGGACTACACCCAGATCAATGTGGGCAATCTGGAGCTGAGTGCCAACCACAACATCCTACAGATTGTAGATGTCTGTATGGAGAGTGAAAAAGACCACAAATTGATCCAGCTGATGGAGGAAATCATGGCGGAAAAGGAAAATAAGACTATAATATTTGTGGAGACAAAGAGGCGCTGTGATGACCTCACACGAAGAATGCGCAGAGATGGTTGGCCTGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGATCTGGAAAGGCTCCTATCCTCATTGCCACGGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTCATCAACTACGATTATCCAAACAGCTCAGAGGATTATGTTCACCGTATTGGCCGAACGGCCCGCAGCACCAACAAGGGCACTGCCTATACTTTCTTTACCCCGGGCAACCTGAAGCAGGCTAGAGAGCTGATCAAAGTATTGGAAGAGGCCAATCAAGCCATCAATCCAAAATTGATGCAGCTTGTGGACCACAGAGGTGGCGGCGGAGGAGGGGGAGGCCGCTCACGATACCGGACTACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGACGAGTGTGACCGGAGGCTTCGAGGGGTCAAGGATGGTGGCCGGAGAGATTCTACAAGCTACAGGGATCGTAGTGAAACCGATAGAGCCAGTTATGCTAATGGCAGTGGCTATGGAAGCCCAAATTCTGCCTTTGGGGCACAAGCAGGCCAATACACCTATGCTCAAGGCACCTATGGGGCAGCTGCCTATGGCACCAGTGGCTACACGGCGCAGGAGTATGCTGCTGGCACTTACGGGGCGAGCAGCACTGCCTCAGCAGGGAGGAGCTCTCAGAGCTCCAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAGCCACAGCCACTGATGTCACAGCAGTTTGCACAGCCTCCAGGAGCTACCAATATGATAGGCTACATGGGGCAGACTGCTTACCAGTACCCTCCCCCTCCCCCTCCCCCTCCTCCATCTCGCAAATGAAACTGCATGGCAGGAGTGACTCGTGCAGATGAATTACACATCTAAAGGAACACTGTCTTTTACCCTTCTAGACCTTTTCATTTTTATTTTTTCTTTTCTCAACCATTACGGTTTATCTTTTTTTAATGCAGATAGTTAAAATTTCACTGCCAGGTTTCTTCTGCCCACCCAAAAGATCCAGTCTATAATTACAGATTTTGTAAGAAAAAATATATATACACATAACTGACTGGAAAGAATTAATTTCTTTCCCCCAGCTTAATGCATGTTGAGGATATTGAGCTATTTTTCATCTTAAAGGTATTAGGCACTTTTGTTGGAGCCTGTTTATCCATGGGAGGGTGGGTAGGGAAGGAGGGACTGCTCTGCAGGAAGTGGTATCTGTTCTTTAGACTGCTCTCCTTAGGGAGGAGCCAAGAGGGATTTCCATGCACACTGCCCATGGTGGGTTTAAGTTACTGAAGTTCGATTACTCAGGCCTGATGAATTTTTAAGACTGCTTTGTTGGTCATTTGGCTGATGGCTTCTTATGTGCATTCAACAGTTAAAAATTCCTAATCGATTCTGTCATCATGCCCCCTCCCCACTTGTTCCTGCAGTTATTAAATATTAACCAGGTTAGTGTTGAGTTAGAAATTACATTTCTGAGTTCAAGCGTTGTCTTTTTAAGTTTAAAAAACTATAAAGGGTTGTTTTTACTAGGTAGACTGGCATCTGGGTAGAGGCTGCCTGGGATTTTTATCCCCACATAACCAGGGGCCATCTGAAAGTCATTTTCTAGCCAGATCAGCCACTGAGCGGTAAGCATCAGCGCTCAGCAGAGCCTTCCGAGCAGCATTTAGAAAGCACCTTTGGGAATGATGGACTGCAAGGGAGTGGGCGGATCTTCCTCTTAAACAGTATTCTTAGAGTAGGATTGACCTCATGGGCTGCTCTGCCCACTTGGTCAGGCTCTCCTGAGCAGGACTGCTAAAGAGCTTGCCTCCTCAAAGCCTGGTCTCTGAGGTGCTTTCTAACAGCTGGAGGCACTTGTTCTGGGCTTTCCTTTGCCCTCAGTTTTTCACAGGTAGGTAGTAGCCATGGAGGGCTGAAGCCCAGGCTCTCCTTACTCTCTGGAGTGTGAAGGTAGGGGTGAGCTCGTCTCACCCCTTTATTAAATGCTCCTGGAACTTGGAAGAGCAGCAGATGAAGTTGGAAAGAAAATTCTGCTCTTATCACCTAAACAGGACAGGAGAGCAGATGCCCCAGCGCCTCTAGTAGATGGTAGTGGTGGGGCTAGTGTGTGGCTGTTACCTGGGCCGCTCAAATTCATTCCAGGGAGGAGGCTCCACTGCATTCTTTGGCTGTGCCCTGAGGGTGCCTGCTCCTTTGTACGGTAACAGTCAATTTTGAGGTTTCTTTCAGGAAGAGAAAGGGATGGTTTTGAGGGGCTCAGAAAATAGGATTCAGTGTGTAACATAACAGGTAGGTTGTCAGCATGCTTGGCATTCTTCTGTTTTCCTTACCGTTTTACAGACTATGAAGCTGAGGGGGGATGGTAGGCACAGATGTGTGGCAACCCTGCTCTGTGCTCTGAAACCAAAGTGTGTCCTGTCTTGTCTGTCTCTCACCCTGCCAAAAGCAAGTGTCTAATCACTGATGCTGACCAGCCTGTTACAGATACTTTCTACAACCAAATTCAGATTTATTTTTTATTAAGCATTATACCATGGGCTGTCCTGTGCTCCTGTCACTCTTCAAAAACACCCCTTCTATTACTGCCTCCGGGGATGAAGCAGTAGCTAGGTTGCTTAACCTCCCCTCTCCAGCAGAGGCATAATCCAGATAAGTAGCAGATGTCATATTTCATAAGCTCTTTTGGCCTGGGTACAGCAGAAAACTAGCAGTTTTCCTACTTGGCGCAAGTGACTTGTGCCTCCTTGTCTGTCCTTTGTCAGCACAGGTGCAGGCAAACCCTTCCAGCTGGGTTAATTGCCGTTTATGGTTTACTCACTTAGGGAAAGGGCTTAGGTGTTAGGCTGTGGGCTGCTTCTCCCTAACCATCCATTGTGCAGACTTCTCATCTAAAAAGGTTGGTGGCTTTTGCTTGGGATCAGTGCTCTGCTAACGCCCTTGCTGGTCTCTCCACACATTCCTGTCATTGAGACTTGAATTGTAGGTGTGATGTTATGCACAGGATGCTCAGAGCTATGTTACTACTATTCTTAGTTTGTAAATTGTCCTTTTGATACCATCTTGTTTTCTTTTGTAGGTATAAATAAATACTTGACAATAAA