Transcript asmbl_17621

Sequence
Transcript Sequence for observation asmbl_17621 of TGE0044960:
AAAAAAGAATGGAGAGGAAATACTCAGAAAGCCACATGTATGAAAAAGGGCTATGAGGAAGTGTCTCAGAAATTCACTTCCATAAGGCGAGTCCGTGGTGATAACTACTGTGCACTGAGGGCCACACTGTTCCAGGCCATGAGCCAGCTGGCCGAGCTGCCCCCCTGGCTGCAGGACTTGGAGCTCATACTGTTACCAGAGAAGCTGATAAACAAGTATACCTGGATCAAGCAGTGGAAACTTGGACTGAAATTTGATGGGAAGAGTGAGGACCTGGTTGAAAAAATTAAGGAATCCCTTGCCCTGCTAAGGAAGAAGTGGGTAAGCCTGGCTGCAATGAAAACTGCTGAAGCGAGGCAGACAGCTTGTGATGAGCTGTTCACCAACGAAGAGGAGGAGTACAGCCTCTACGAAGCTGTGAAGTTCCTGATGTTAAACAGAGCCATCGAACTGTACGATGACAAGGAGAAGGGAAAGGAAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCTCCTGAGGAACCACCTAAACCAGGTTGAGATGTTCCTTCTTGCCTATGCTGTCCGCCACAGCATCCGGGTGTACCGGCTGTCCAAGTATAACACAGAGGAGTTCATCACAGTCTACCCCACTGATCCCCCCAAGGACTGGCCAATGGTGACCCTCATAGCTGAGGATGATCGGCACTATAACATCCCTGTCAGAGTGTGTGAGGAGACCAGTGTGTGAGGGACACACATGTGACTGCCAAGAGATGCGCATGTGCAGCTCCTCCTCTGGGGGCCTCAGATCTGCAGGTCTCCAAGGACAATCTGGGAGAACTCTCGGGCCCCTGGAGCCAACTTTGGACCATTATGTTCTGAAGACTAGCTGTTGATAATGAGAATTAATTAGCCAAGCCTTCACTCCTTGTTCTGTTATGCAGTGTGTTCCACTGGGGGCTTCAGCACGTGCCTTTGGAAGGTGCAAACTATGTCTCCATAAGGCGGATGCTTTTGGGTCAAAGAAAACTGTTTGGAAAGGAATCTGTCCAATGAAAGTTCTGACGGTAAACTGGTTTTACTTCTCTTTTTAAAACAGTA