Transcript asmbl_17612

Sequence
Transcript Sequence for observation asmbl_17612 of TGE0032183:
ACCCAGCGCAGGAAGCCGAGCAGGAAGCGAGCCCGGCAGCCGCACTTTCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGGTATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAAGTTTCGGAAGAGCGATACAAACGAGTGGAACAAGAATGATGACCGTCTGCTGCAGGCTGTGGAGAACGGAGATGCTGAGAAGGTGGCCTCACTGCTGGGCAAGAAAGGGGCCAGCGCCACGAAGCATGACAGCGAGGGCAAGACCGCTTTCCACCTTGCCGCTGCGAAGGGACACGTGGAATGCCTCAAGGTCATGGTGACACACGGTGTGGATGTGACTGCCCAAGATTCTTCCGGTCACAGTGCTTTGCATGTCGCAGCCAAGAATGGCCACCCAGAGTGCATCAGGAAGCTTCTTCAGTACAAGAGCCCAGCGGAGAACATTGACAACTCGGGGAAAACAGCTTTGCATTATGCAGCGGCACAGGGATGCCTTCAGGCTGTACAGCTCCTCTGCGAACACAAGAGCCCCATAAACCTTAAAGACTTGGATGGGAACATCCCCCTGCTTGTTGCAGTCCAGAACGGCCACAGTGAGGCCTGCCACTTTCTCCTGGATCACGGCGCAGATGTCAATTCCAGAGACAAAAATGGAAGAACTGCTCTCATGCTGGCTTGTGAAACCGGCAGCTCGAACACTGTGGACGCCTTAATTAAAAAGGGAGCGGACCTGAGCCTTGTCGATTCTCTCGGACACAATGCCTTACATTATTCCAAACTCTCGGAAAATGCAGGAATTCAAAACCTTCTATTATCAAAAATCTCTCAGGATGCTGATTTAAAGACTCCAACAAAACCAAAGCAGGCTGAGATCAGCTCCATACAAGAAAACAAAGACAGGCTGAGCGACAGTACTGCAGGTGCTGACAGCTTGTTGGATATAAGTTCTGAAGCTGACCAACAAGATCTTCTTGTCCTGTTGCAAGCAAAAGTCGCTTCCCTTACCTTACACAATAAGGAGTTACAAGATAAATTGCAGGCCAAATCGCCCAAGGACAAGGAAGCGGAAGCCGACCTAAGCTTTCAGTCTTTCCATTCGACCCAGACTGACCTGGCCCCATCCCCGGGCAAAGCTAGTGACATCCCTTCCTCCGATGCCAAATCATCCCCACCCGTTGAGCATCCGGCGGGGACGTCCACCACTGACAATGATGTCATAATCCGGCAGCTCCAAGATTCCCTGCATGATCTGCAGAAGAGATTGGAGAGCTCCGAAGCAGAGAAGAAACAGCTCCAGGACGAACTCCAGTCACAAAGGACAGACACGCTTTGCTTGAACAACACAGAGATCTCCGAGAATGGCTCTGACCTCAGTCAGAAGCTCAAGGAAACCCAGAGCAAGTACGAAGAGGCCATGAAAGAAGTCCTGAGCGTGCAGAAACAGATGAAGCTGGGTCTCCTCTCCCAGGAGAGCGCCGATGGCTACTCGCATCTCCGGGAGGCGCCAGCTGACGAAGACATCGACACACTAAAGCAAGACCTGCAGAAAGCGGTGGAAGAAAGTGCAAGGAACAAGGAGCGGGTGCGGGAGTTAGAGACTAAGCTTGCGGAGAAGGAGCAGGCCGAAGCGACTAAGCCACCTGCCGAGGCGTGTGAGGAGCTGAGAAGTTCCTACTGCTCTGTTATCGAGAATATGAATAAGGAGAAGGCATTTTTGTTTGAGAAATATCAACAGGCCCAAGAAGAGATCATGAAACTGAAGGACACGCTAAAAAGTCAGATGCCACAGGAAGCCCCCGACGACTCTGGGGATATGAAAGAGGCCATGAACAGGATGATTGATGAACTCAATAAACAGGTGAGCGAGCTGTCACAGCTGTACCGAGAAGCCCAGGCAGAGCTGGAGGATTACAGGAAGAGGAAATCTCTGGAAGATGCAGCCGAGTACATTCACAAAGCTGAACACGAGAGGCTGATGCACGTGTCAAACCTGTCCAGGGCCAAGTCGGAAGAAGCGCTGTCGGAGATGAAGTCTCAGTATTCCAAAGTGTTGAACGAGTTGACTCAGCTCAAACAGCTGGTGGATGCACACAAAGAGAACTCCGTGTCCATCACAGAGCATTTGCAAGTGATAACCACGCTGCGGACAACGGCCAAAGAGATGGAAGAAAAGATAAGCGCCCTCACAGGGCACCTTGCAAACAAGGAAGCGGAAGTGGCAAAGCTGGAGAAGCAGCTCGCCGAAGAGAAGGCTGCCGTGAGCGACGCGATGGTCCCCAAGTCTTCCTACGAGAAGCTCCAGGCCTCCTTGGAGAGCGAAGTCAATGCCTTAGCAACAAAGTTAAAGGAGTCAGTAAGAGAGAGAGAGAAAGCCCATTCCGAGGTGGCCCAGGTTCGAAGTGAGGTCTCACAGGCGAGAAGGGAAAAGGACAACATCCAGACTCTCTTGAAAGCCAAAGAGCAGGAAGTAACTGCGCTTGTGCAGAAGTTCCAGCGAGCTCAGGAAGAACTGGCTGGGATGCGAAGATGCTCTGAGACCTCGTCGAAGCTGGAGGAGGATAAAGATGAAAAGATAAATGAAATGACCAGGGAAGTCCTGAAGCTGAAGGAGGCCCTGAACAGCCTCTCGCAGCTCTCCTACTCCACAAGTTCATCCAAGAGGCAGAGCCAGCAACTGGACCTGCTACAGCAGCAGGTCAAGCAGCTGCAGAACCAGCTGGCTGAATGTAAGAAACACCACCAGGAGGTCATCTCAGTTTACAGAATGCATCTTCTATATGCCGTTCAGGGCCAAATGGATGAAGATGTCCAGAAGGTCTTGAAGCAGATCCTCACCATGTGTAAAAACCAGTCTCAGAAGAAGTAAAAATGGATTCTTTGGCAGGACACTTGCCCCTCGTTGCCTCTCTTTGTGTTAGATCTGGGGTTGTCACTGACCACTGCCATTGTTCTTATCCATAGTGTGCACTGTGACCCATCGTAGCATCTTTTCCAGAGGTTTCTGAGGGCTAGTCCCAAGAGAAGATACCCTCTTCAGAACTGCATAGGTACTCCAGACCAGCAGAGGTGAAAGACCCTGCTATCTCTTCAGAATCTAGCACTGGGATTGGCACCATCCCGGTGGCTTTATGGAGTGATGTGCTGAAGCCACCATGCAGTGAGTGGTCCTTGATCCCTGCCTTTGGGATGTGCCATTCAGCACAGGAGAGCATTTTGCCTTCCATTCCCCAAATATGATTTAATTCCTAACCAAACTAAAATGACACTAGAAGTGAATGCTTAAGACCCTTTCTCCTGTGGATTTAAAAACTCTACTCTGTCCCCCCAGCTGCCTTAAATCTCATCCCCTTGCTTGTGGTCTCATCATTTGATGAGTATCATTAACTAAAGTACAACGTTTTAAGCCAAGAGTGAAGTCTCCTTAAAAGTTTTCAGTAAGTCAACATACTGTAAATTTTCTATGCAAACTTGCCTAGAAAACTTTCCACAATGCTCAGGAAGTCCAGATATTTGTATTTCAACAAAGGACAGTAAACTATGTGTTTACAGCCAAAAGACATGCCTCATAGTTCTTAACCTCAATTTTTTAAAAGTGTTTTTTTTCCTCTATGATATTTTTATTGGCTTTTAAAGATGTTTTCATAGCTAAAGCCCTAAGTAAGTGAGATTAGATTATATTAACATTATTTTTAGATAAACATACTTAAGACTTCTCAAAAATGTAACTTTTTCCTCAAAAGTTTTCAGAGGGTAGTTATATATTCCAAACTCAGTATGAGCTGCCACCAGAACCACTAGGAATTTCTGTAGTCTACTTCTGAATGCAGTAAATACTCCTTTTGCCCGTTGAACTTGTAAACACCTCAAACTCTAGCACCCACGAATGATTCCTGAAAGGGCTGTCAGTTCCAGTCAGCTTCTCCATGTTGAAAGTAAAAGTTCCAACATGGCACCGCGGTGCATAGCAGAAACCTCGGGGGAAATACGCCTACCGACCTTACTTTCAGGTTGAAAAGGTTCAACTTGCTTGCAGCTTCTCTTACAGCCCCCATGGTGAGGGAGATAAATGAAATAAAGGAACTTTGGGTGTGTTACTAAAGGTAGCGGTCTACTCTGACAGGACCCATCTGAGGCCACGTGGCTGAGTTGGGTCTGTTCATCTGTCTTAGG