Transcript asmbl_57095

Sequence
Transcript Sequence for observation asmbl_57095 of TGE0006472:
GTGTTTGCAAACCAGCCAGGGTAGTTTGGGCAGCTTTCTTCCTCCTGGTCAGATACTTCCACTTTCAGTTGTGAAAGAAAAACCAGGAAGTGAAGTCCCCGAGCACGTTAGGAAGCCCGGCCACGGCCTGACTCCGGACAGGGCGGACGGGGTGCTCTGAGCTGTGGCCATCTGCCCGCATGAATGTTCTGAAGCCATCCTGTCCCTGGAGAAAACAGGGGTGAGGAGGAAGAACAGGGACTCGTGTGCCAGGAAGAACTCGGAGCCAGGAAGCCCCATTTGCTGGAAACACCAAGAGATGTGGCCCCCCTCACAGGGCCTGAATTTCCTGCTGCTATTCACAAAGATGCTTTTTATCTTTAACTTCTTGTTTTCCCCACTTCCAACTCCGGCACTGATCTGCATCCTGACCATTGGAGCTGCCATCTTCCTATGGCTGATGAACAGACCTCAGCCAGTCTTGCCTGATATTGATCTGAACAACCAGTCAGTGGAAATTGAGGGAGGAGCACGGAGGAGCGCAAAACAGAAAGACGACGAACTGCTCTCTTACTACTTCTCAGATGTCAAGACAATATACGAAGCTTTCCAAAGAGGACTGGTTGTATCTGGCAATGGGCCTTGCTTGGGATATAGAAAACCAAATCAGGACTACAGATGGCTGTCCTACAAACAGGTGTCTCATCGAGCAGAGTACCTGGGCTCCTGTCTCTTGCATAAAGGATATAAGCCATCACCAGACCAATTTGTTGGCATCTTTGCTCAGAATAGGCCAGAGTGGATCATCTCGGAGTTAGCTTGTTACACGTACTCCATGGTGCCTGTCCCCCTGTATGATACCTTGGGAGTAGAAGCTGTCGTGTACACTATCAACAAGGCTGATATTGCCATGGTGATCTGTGATACACTCCAAAAGGCATTGGTCCTGATAGGAAATGTGGAGAAGGGCCTCATCTCAGGCCTAAAAATAATCATCCTCATGAATTCCTTTGAAGATGACCTGAAGCAAAGAGGGGAGAAAAGTGGAATAGAGATCTTATCCTTCTCTGAAGCTGAGAATATAGGCAGAGAGAACTTCAGAAAACCCGTGCCACCTACACCAGAAGATCTGAGCATCATCTGCTTCACCAGTGGAACCACAGGTGAGCCCAAAGGGGCCATGCTAACCCATCAAAATGTCATTTCAAATGCTGCTGCTTTTCTCAAACTTTTGGAGGACAGCTTCCAGCCCACTCCCAAGGATGTGACCATATCCTACCTCCCCTTGGCTCATATGTTTGAGAGGGTTGTACAGGTTATTATGTACTCTTGTGGAGCCAGAGTTGGGTTCTTCCAGGGAGATATTCGGTTGCTGCCCGATGACATGAAGACTCTGAAGCCCACGGTGTTTCCCATAGTGCCTCGACTCCTTAACAGGATCTACAATAAGGTTCAAAATGAAGCAAAGACACCCTTGAAGAAGTTCTTGTTGAACTTGGCTGTTGCCAGTAAAATCAATGAAATGAAAAAGGGTATCATCAGACGCAACAGTTTCTGGGACAAGCTCATCTTTGCAAAGATCCAGGACAGCCTGGGTGGGAAGGTCTCCTTAATGATCACTGGAGCTGCCCCCATCGCCTCTCCTATCTTGACATTCTTCCGGGCAGCAATGGGATGTATGGTGCTTGAAGCTTATGGACAAACGGAATGCACTGCGGGCTGTACATCTACGTTACCTGGAGACTGGACGTCAGGCCATGTTGGAGTCCCTGTACCTTGCAATCACGTGAAGCTGGAAGATGTGGCTGACATGAACTACTTTTCGGCAAACAACGAAGGAGAGATCTGCGTCAAGGGAAGCAGTGTGTTCAAAGGATACCTGAAGGACCCTGAGAAGACAAATGAAGCCCTGGACAAGGACAACTGGCTTCACACAGGAGACATTGGTCGCTGGCTCCCGAATGGAACTCTGAAGATCATTGATCGAAAAAAGCACATTTTCAAGCTGGCCCAAGGAGAATACATTGCTCCAGAGAAGATAGAAAATATCTACATCAGGAGTAAACCTGTGCTGCAAATTTTTGTACACGGGGAAAGCTTATGGTCATTCTTAATAGCAGTGGTGGTTCCTGACCCAGACGTACTTCCCTCATTTGCAGCCAAAATTGGGGTTAAGGGCTCTTTTGAAGAACTGTGCCAAAACCAAGTTGTAAAGGAAGCCGTTTTAGAAGACTTGCAGAAAATTGGGCAAGAAAATGGCCTTAAAACCTTTGAACAGGTCAAAGACATTTATCTTCATCCGGAGCCATTTTCCACTGAAAATGGGCTCTTGACACCAACACTGAAATCAAGGCGGGAACAGCTTGCCAAGCACTTTCAGACACAGATCAACAGCCTGTATAAGGACATCTAGGAGTAGGCTAAGGTACTGCTGGGAGGGGCTCAGTAGTATGTCTTGTGGGAATATGACTTAAAAACTAGTCTTATGTTCACTACTTGTCTTTCTGCCTGTCTATTGTTCTACCTACTAAATTATAAAACTATAGTTTGGGGGCTTTTTAAAAATAATATTAAGTGAGAAACTTATAATGTGGATGCTTGGCCCCGAACTAAATAAATCTTGTCCTTCCCATCTTAAATGTTGCTAACATTTAGGTTTTCGGGCTACTTTTATCAACATTCCTTTCTTCAAGGTCCATTTGTATTCTTTGTCCTTTCCCCATGACCTCCAACCTGTACAAGTGACCACTAGTTCAAGAGCCAAAGGGACCCTCTGACTTCTTGTTTTCTAGTAAAACCTAGTATGTCAACAGTTCCAGCACTTAGGCCTTCCAGTGTTCAAGTTAAGAGACTTTTCAATGACAAAAAGCTGTCCGTAATTCATGTTTTCTTACTCCACCAAAACATGAAAATTTTGAACCAGCCAGT