Transcript asmbl_16329

Sequence
Transcript Sequence for observation asmbl_16329 of TGE0032154:
GCCGAGGTGCGCGCTGGTGGGGAGGGGGGGCCTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGAGCCTGGCCCAACTAGAGAATCTGTGCAAACAGTTGTATGAAACAACAGATACAACCACTCGACTGCAGGCAGAGAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTGCTCCTCGAGAGAGGAAGTTCGTCCTACTCCCAGCTGCTGGCAGCTACATGCCTTACCAAGCTCGTGTCTCGGACAAACAACCCCTTGCCACTGGAGCAGCGGATAGATATCCGGAACTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCAACTTTCGTGACTCAAGCCCTCATCCAGCTGTATGCCAGGATCACAAAGCTGGGCTGGTTTGACTGCCAGAAGGATGACTATGTCTTCAGAAACGCAATCACAGACGTCACAAGGTTCCTGCAGGACAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTCACCAATGAAATTAATCAAGCAGACACAACTCATCCTTTAACCAAACACAGAAAAATAGCCTCTTCTTTCCGAGACTCATCACTGTTTGATATCTTCACACTTTCCTGCAATTTACTAAAACAGGCATCAGGAAAGAATCTGAACTTGAATGATGAAAGTCAGCATGGCTTGCTAATGCAACTGCTCAAACTCACCCACAACTGTCTGAACTTTGATTTTATCGGCACATCTACTGATGAGTCCTCAGACGACCTGTGTACAGTGCAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCGACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATTCCTCCCTCGTTCTCACCTTTGGTATTGTCCTGCTTAGTACAGATTGCCTCAGTCCGGAGATCCCTATTTAACAATGCTGAGAGGGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTCTGCAGACTACTGGCTCGGTTAAAGAGTAACTACCAACTGGGAGAACTGGTAAAAGTGGAAAACTACCCTGATGTTATCCGATTGATAGCCAACTTCACAGTGACCAGCCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTACCATATGTCAAAGCCACAGAGCCCCATATGCTGGAAACATATACTCCTGAGGTTACCAAAGCCTATATCACATCCCGCTTGGAATCTGTGCACATCATTCTGAGGGATGGCCTGGAAGATCCCCTGGAAGATACAGGTCTGGTCCAGCAACAGCTGGACCAGCTGTCCACCATCGGGCGTTGTGAGTATGAGAAGACATGCGCGCTCCTTGTGCAGCTATTTGACCAGTCGGCCCAGTCGTACCAAGAACTGCTGCAGAGTGCCAGTGCCAGCCCAATGGACATTGCAGTGCAGGAGGGACGACTGACGTGGTTAGTCTATATCATTGGAGCTGTGATTGGTGGCCGAGTTTCTTTTGCCAGCACTGATGAGCAAGATGCAATGGATGGTGAGCTTGTCTGTCGGGTGCTCCAGCTTATGAACCTGACAGATTCCCGCTTGGCTCAGGCTGGTAATGAGAAGCTTGAATTGGCCATGCTGAGTTTTTTTGAGCAGTTTCGTAAGATCTACATTGGGGATCAGGTGCAGAAATCCTCAAAGCTGTACCGCCGACTCTCAGAAGTTCTGGGATTGAATGACGAGACGATGGTGCTGAGTGTCTTCATAGGAAAAGTCATCACCAACTTGAAGTACTGGGGTCGTTGTGAGCCAATCACCTCCAAGACACTGCAGCTCCTCAATGACCTCTCCATCGGATACAGTAGCGTAAGGAAGTTAGTGAAGCTTAGCGCTGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACTACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCTCTAACAGCAGCGTTTGAGGCTGTGGCCCAGATGTTCAGCACTAACAGCTTCAATGAACAGGAGGCAAAGAGAACTCTGGTTGGCCTAGTGAGAGACCTGAGAGGGATAGCCTTTGCCTTCAATGCCAAGACCAGTTTCATGATGCTCTTCGAATGGATATACCCCTCCTACATGCCAATTCTCCAGCGGGCAATTGAGCTCTGGTACCATGACCCAGCCTGTACCACTCCTGTGCTCAAGCTGATGGCTGAATTAGTTCATAACAGATCTCAGCGACTCCAATTTGATGTTTCATCTCCCAATGGTATCTTACTTTTCCGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTGCCAAAGGATCAGGTCTATGCTTTGAAGCTCAAGGGTATCTCCATCTGCTTCTCCATGCTGAAGGCTGCCCTCAGTGGGAGTTATGTCAACTTTGGGGTCTTCCGTCTCTATGGAGATGATGCCTTGGAAAATGCCCTACAGACCTTCATCAAACTACTCCTCTCTATTCCTCATAGTGACCTCCTGGATTACCCCAAGCTCAGCCAGTCTTACTACTCACTACTGGAAGTCCTGACCCAGGACCATATGAACTTTATTGCAAGCCTGGAACCTCATGTCATCATGTACATCCTCTCTTCTATTTCTGAAGGACTTACTGCACTTGACACCATGGTATGCACGGGCTGCTGTTCCTGCCTAGACCATATTGTGACGTATCTCTTCAAACAGCTGTCACGGAGCACCAAGAAAAGGACAACACCCCTGAACCGGGAGAGTGACTGCTTTCTGCATATCATGCAGCAGCATCCAGCTATGATCCAGCAGATGCTGTCCACGGTGCTGAACATCATTATCTTTGAAGATTGTAGGAATCAGTGGTCTATGTCTCGACCCCTGCTTGGCTTAATACTGCTTAATGAAAAGTATTTTTCTGACCTAAGAAACAGCATCGTCAATAGCCAACCACCAGAGAAACAGCAGGCCATGCATCTGTGTTTTGAAAATTTGATGGAAGGCATTGAACGGAATCTTCTGACGAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAGGTCAACGACTCAATGAAGAATTCCACTTATGGAGTGAATAGCAATGACATGATGAGCTGACAACTCTCGGACTCTACCTTGCAGAGCAGCGTCCCTTTGGTCTGGTCCAGAGGGTGAACAGTTGCAAGGGAGAGAGCCTGGCTGATCCCGGCTCCTTCCTCCAGGGGTATGGGGGAAATGGCAAAAGTCAACCAGCTATTTCCCCAGAAAGTACGGGGAAGTACGGGGTGTGCGTGCACTCACTGAGGGACAGGGCACTGCTGGTTCCTG